Vasopressin-activated calcium-mobilizing receptor-1

Target ID:

CUL5A

Aliases:

CUL5VACM-1VACM1

Deposition Date:

Monday 30th November 2009

Families:

Signalling proteins

Structure type:

apo

Download Coordinates:

2WZK

Authors:

J.R.C.Muniz,V.Ayinampudi,Y.Zhang,J.J.Babon,A.Chaikuad,T.Krojer,A.C.W.Pike,M.Vollmar,F.vonDelft,C.H.Arrowsmith,A.M.Edwards,J.Weigelt,C.Bountra,A.Bullock

Site:

Oxford

2WZK

tabs

Structure Details

Cullin 5, also called Vasopressin Activated Calcium Mobilizing receptor (VACM-1) was first identified in rabbit as a protein that produces an increase in high-affinity arginine vasopressin binding and enhanced Ca2+ mobilization leading to elevated intracellular calcium concentrations (Byrd et al., 1997). Cullin 5 is expressed in the kidney in collecting tubule cells as well as endothelial structures of a variety of tissues (Burnatowska-Hledin et al., 1999).

Cullin 5 is now recognized for its role in E3 ubiquitin ligase complexes, which target substrates for ubiquitin-dependent, proteasome-mediated degradation. In the cullin-ring ligases (CRL) E3 class it thereby acts as a scaffold protein bridging the substrate binding SOCS adaptor proteins and the E2 ubiquitin-conjugating enzyme (Petroski and Deshaies, 2005). By modifying the availability of target proteins Cullin 5 is involved in a variety of biological functions including cellular proliferation and growth. In particular, Cullin 5 has been shown to regulate neuron migration, angiogenic growth and granulocyte differentiation (Feng et al., 2007), (Buchwalter et al., 2008), (Baxter et al., 2009). It has also been implicated in controlling transcription in response to DNA damage via degradation of the pol II subunit, Rpb1(Yasukawa et al., 2008).

The HIV protein Vif has been shown to hitch-hike the E3 ligase complex via its interaction with Cullin 5 to mark the host antiviral factor CEM15/APOBEC3G for degradation (Izumi et al., 2008). Cullin 5 has also been proposed to act as a tumor suppressor as mRNA expression has been found to be downregulated in a number of poor-prognosis breast cancers and neuroblastomas (Fay et al., 2003). Cullin 5 expression can inhibit growth by attenuating estrogen-dependent signaling responses in a breast cancer cell line (Burnatowska-Hledin et al., 2004). Recently, Laszlo et al have shown that Cullin 5 not only regulates normal Src activity but counteracts mutant Src thus acting as tumor suppressor (Laszlo and Cooper, 2009).

Here we report the structure of the N-terminal domain (NTD) of Cul5 at 2.05Å resolution.

Materials and Methods

Entry Clone Source: Collaborator

Entry Clone Accession: n/a

SGC Construct ID: CUL5A-c001

GenBank GI number: gi|38257756

Vector: pNIC-CTHF. Details [ PDF ]; Sequence [ FASTA ] or [ GenBank ]

Coding DNA sequence:
CTGGTTCCGCGTGGATCCAATGTGCAGGG
ACATCTTCCCCTCGTACCACGAGGTTCAA
TGGCGCGCCAGATGGCGACGTCTAATCTG
TTAAAGAATAAAGGTTCTCTCCAGTTTGA
AGACAAGTGGGACTTCATGCATCCAATTG
TTTTGAAGCTTTTACGCCAGGAATCTGTA
ACAAAACAGCAGTGGTTTGATCTATTTTC
GGATGTACATGCTGTCTGTCTCTGGGATG
ATAAAGGCTCATCAAAAATTCATCAGGCT
TTAAAAGAAGATATTCTTGAGTTTATTAA
GCAAGCACAGGCTCGTGTACTGAGCCATC
AAGATGACACAGCTTTGCTGAAGGCATAT
ATTGTTGAATGGCGGAAATTCTTCACACA
GTGTGATATTTTACCAAAACCTTTTTGTC
AATTAGAGGTGACTCTATTGGGTAAACAA
AGCAGCAATAAAAAATCAAATATGGAAGA
CAGTATTGTTCGAAAGCTCATGCTTGATA
CGTGGAATGAGTCGATTTTTTCAAATATA
AAGAACAGACTCCAGGACAGTGCAATGAA
GCTGGTGCATGCTGAGAGATTAGGGGAAG
CTTTTGATTCCCAGCTGGTCATCGGGGTG
CGAGAGTCCTATGTTAATCTTTGCTCCAA
CCCCGAGGACAAGCTTCAGATCTATAGGG
ATAATTTTGAGAAGGCATACTTGGACTCA
ACAGAGAGGTTTTATAGAACACAGGCACC
CTCATATTTACAGCAAAATGGTGTGCAGA
ATTACATGAAATATGCAGATGCTAAATTA
AAAGAAGAAGAAAAAAGAGCACTCCGATA
CTTAGAAACACGACGAGAGTGTAACTCTG
TGGAAGCACTCATGGAATGCTGTGTAAAT
GCGCTGGTGACCTCCTTTAAAGAGACTAT
TTTAGCAGAATGCCAAGGCATGATCAAGC
GAAATGAAACTGAAAAGTTACATTTGATG
TTTTCCTTGATGGACAAAGTTCCTAATGG
GATAGAGCCGATGTTGAAGGACTTGGAGG
AGCATATTATAAGTGCGGGCCTAGCAGAC
ATGGTGGCCGCAGCTGAAACCATCACTAC
TGACTCTGAGAAGTATCGGGAGCAATTAG
ACACACTGTTTAATAGATTCAGTAAACTG
GTCAAAGAAGCTTTTCAGGATGATCCTCG
TTTCCTTACTGCAAGAGATAAGGCATATA
AAGCAGTTGTTAATGATGCTACTATATTT
AAATAAGCGGCCGC

Tags and additions: enlyfq*shhhhhhdykddddk, TEV-cleavable (*) C-terminal hexahistidine and FLAG tag.

Host: BL21(DE3)-R3-pRARE2 (Native) and B834(DE3) (Selenomethionine labelling)

Expressed protein sequence (tag sequence in lowercase):
MATSNLLKNKGSLQFEDKWDFMHPIVLKL
LRQESVTKQQWFDLFSDVHAVCLWDDKGS
SKIHQALKEDILEFIKQAQARVLSHQDDT
ALLKAYIVEWRKFFTQCDILPKPFCQLEV
TLLGKQSSNKKSNMEDSIVRKLMLDTWNE
SIFSNIKNRLQDSAMKLVHAERLGEAFDS
QLVIGVRESYVNLCSNPEDKLQIYRDNFE
KAYLDSTERFYRTQAPSYLQQNGVQNYMK
YADAKLKEEEKRALRYLETRRECNSVEAL
MECCVNALVTSFKETILAECQGMIKRNET
EKLHLMFSLMDKVPNGIEPMLKDLEEHII
SAGLADMVAAAETITTDSEKYREQLDTLF
NRFSKLVKEAFQDDPRFLTARDKAYKAVV
NDATIFKAenlyfq*shhhhhhdykdddd
k

Growth medium, induction protocol: A glycerol stock was used to inoculate a 10ml starter culture containing LB media with 50µg/ml Kanamycin and 34 µg/ml chloramphenicol. The starter culture was grown overnight at 37°C with shaking at 200 rpm. The following morning, four flasks containing 1 L LB/kanamycin/chloramphenicol were each inoculated with 5 ml of the starter culture. Cultures were incubated at 37°C with shaking at 180 rpm until an OD₆₀₀≥ 0.7 was reached. The flasks were then cooled down to 18°C and 0.5mM IPTG added to induce protein expression overnight. Cells were harvested by centrifugation at 4500 rpm at 4°C for 15 min. Cell pellets from each flask were resuspended in 30ml binding buffer (50mM HEPES, pH 7.5; 500mM NaCl; 5% Glycerol; 5mM Imidazole), transferred to 50 ml tubes, and stored at -20°C. The protocol was repeated for subsequent selenomethionine labeling using a 6L expression from the B834(DE3) strain, including 40 mg/L L-selenomethionine.

Extraction buffer, extraction method: The frozen cells were thawed and 0.5mM TCEP, 1mM PMSF, 50mM L-Arginine, 50 mM L-Glutamic acid added to the cell suspension. The cells were lysed by ultrasonication over 12 min with the sonicator pulsing ON for 5 sec and OFF for 15 sec. The cell lysate was spun down by centrifugation at 17000 rpm at 4°C for 1 h. The supernatant was recovered for purification.

Column 1: Ni-Affinity Chromatography.
5ml of 50 % Ni-sepharose slurry (Amersham) was applied onto a 1.5 x 10 cm column. The column was first washed with deionised distilled H₂O, and then equilibrated with binding buffer.

Buffers:
Binding buffer: 50mM HEPES, pH 7.5; 500mM NaCl; 5% Glycerol; 5mM Imidazole;
Wash buffer: 50mM HEPES, pH 7.5; 500mM NaCl; 5% Glycerol; 30mM Imidazole;
Elution buffer: 50mM HEPES, pH 7.5; 500mM NaCl; 5% Glycerol; 50 to 250mM Imidazole.

Procedure: The supernatant was applied by gravity flow onto the Ni-sepharose column. The bound protein was eluted by applying a step gradient of imidazole (5 ml fractions of elution buffer supplemented with 50mM, 100mM, 150mM and 250mM imidazole). 10mM DTT was added to each fraction collected for overnight storage at 4°C.

Enzymatic treatment: TEV protease cleavage. Fractions containing CUL5 were treated with TEV protease overnight at 4°C.

Column 2: Size Exclusion Chromatography – S200 HiLoad 16/60 Superdex run on ÄKTA-Express.

Buffer: Gel Filtration buffer: 300mM NaCl, 50mM HEPES pH 7.5, 0.5mM TCEP

Procedure: Prior to applying the protein, the S200 16/60 column was washed and equilibrated with gel filtration buffer. Eluted protein from the Ni-sepharose column was cleaved with TEV protease and pooled and concentrated to 5ml using an Amicon Ultra-15 filter with a 30kDa cut-off. The concentrated protein was directly applied onto the equilibrated S200 16/60 column, and run at a flow-rate of 1 ml/min. The protein was eluted at 90 – 110 ml. Fractions containing the protein were pooled together, and 10mM DTT was added for overnight storage at 4°C.

Column 3: Ni-Affinity Chromatography.
500µl of 50 % Ni-sepharose slurry was applied onto a Biorad Poly-Prep disposable drip column. The column resin was first washed with deionised distilled H₂O, and then equilibrated with binding buffer.

Procedure: The fractions containing CUL5 from gel filtration were applied by gravity flow onto the Ni-sepharose column. The flow through was collected, washed the column with 10ml Wash buffer and the bound impurities were eluted with 500µl of elution buffer with 250mM Imidazole. 10mM DTT was added to the flow through.

Concentration: The protein was concentrated in an Amicon Ultra-4 filter with a 30 kDa cut-off.

Mass spectrometry characterization: The purified native protein was homogeneous and had an experimental mass after tag cleavage of 45335.8 consistent with loss of the N-terminal methionine (calculated MW of this species = 45333.8). For the selenomethionine-labelled protein an experimental mass of 45853.8 kDa was observed, as expected for the incorporation of 11 selenomethionine residues. Masses were determined by LC-MS, using an Agilent LC/MSD TOF system with reversed-phase HPLC coupled to electrospray ionisation and an orthogonal time-of-flight mass analyser.

Crystallisation: Protein was buffered in 50mM HEPES, pH 7.5, 300mM NaCl, 10mM DTT, 0.5 mM TCEP, 10 mM L-arginine, 10 mM L-glutamic acid. Protein was concentrated to 16 mg/ml (calculated using extinction co-efficient of 45380). Native crystals were grown at 20°C in 150 nl sitting drops mixing 50 nl protein solution with 100 nl of a reservoir solution containing 0.1M BisTris pH 6.5, 25% PEG 3350, 0.15M NH₄SO₂. On mounting crystals were cryo-protected with an additional 25% ethylene glycol.
Crystals of the selenomethionine-labelled protein (16 mg/ml) were grown at 20°C in 150 nl sitting drops mixing 75 nl of protein solution with 75 nl of reservoir solution containing 20% jeffamine ED-2001 reagent pH 7.0, 0.1 M HEPES pH 6.8.

Data Collection: Resolution: 2.05Å, X-ray source: Diamond I02 (native) and IO3 (selenomethionine). The native crystal diffracted to a resolution of 2.05 Å and the selenomethionine-derivatized crystals diffracted to 2.27 Å. Both datasets were collected at 100 K. Data were indexed and integrated using iMOSFLM and scaled using SCALA. Phases were found using selenomethionine SAD data and extended to the highest resolution with SOLVE.

References

Baxter, S.S., Carlson, L.A., Mayer, A.M., Hall, M.L., and Fay, M.J. (2009). Granulocytic differentiation of HL-60 promyelocytic leukemia cells is associated with increased expression of Cul5. In Vitro Cell Dev Biol Anim 45, 264-274.
Buchwalter, A., Van Dort, C., Schultz, S., Smith, R., Le, I.P., Abbott, J.L., Oosterhouse, E., Johnson, A.E., Hansen-Smith, F., and Burnatowska-Hledin, M. (2008). Expression of VACM-1/cul5 mutant in endothelial cells induces MAPK phosphorylation and maspin degradation and converts cells to the angiogenic phenotype. Microvasc Res 75, 155-168.
Burnatowska-Hledin, M., Lazdins, I.B., Listenberger, L., Zhao, P., Sharangpani, A., Folta, V., and Card, B. (1999). VACM-1 receptor is specifically expressed in rabbit vascular endothelium and renal collecting tubule. Am J Physiol 276, F199-209.
Burnatowska-Hledin, M.A., Kossoris, J.B., Van Dort, C.J., Shearer, R.L., Zhao, P., Murrey, D.A., Abbott, J.L., Kan, C.E., and Barney, C.C. (2004). T47D breast cancer cell growth is inhibited by expression of VACM-1, a cul-5 gene. Biochem Biophys Res Commun 319, 817-825.
Byrd, P.J., Stankovic, T., McConville, C.M., Smith, A.D., Cooper, P.R., and Taylor, A.M. (1997). Identification and analysis of expression of human VACM-1, a cullin gene family member located on chromosome 11q22-23. Genome Res 7, 71-75.
Fay, M.J., Longo, K.A., Karathanasis, G.A., Shope, D.M., Mandernach, C.J., Leong, J.R., Hicks, A., Pherson, K., and Husain, A. (2003). Analysis of CUL-5 expression in breast epithelial cells, breast cancer cell lines, normal tissues and tumor tissues. Mol Cancer 2, 40.
Feng, L., Allen, N.S., Simo, S., and Cooper, J.A. (2007). Cullin 5 regulates Dab1 protein levels and neuron positioning during cortical development. Genes Dev 21, 2717-2730.
Izumi, T., Shirakawa, K., and Takaori-Kondo, A. (2008). Cytidine deaminases as a weapon against retroviruses and a new target for antiviral therapy. Mini Rev Med Chem 8, 231-238.
Laszlo, G.S., and Cooper, J.A. (2009). Restriction of Src activity by Cullin-5. Curr Biol 19, 157-162.
Petroski, M.D., and Deshaies, R.J. (2005). Function and regulation of cullin-RING ubiquitin ligases. Nat Rev Mol Cell Biol 6, 9-20..
Yasukawa, T., Kamura, T., Kitajima, S., Conaway, R.C., Conaway, J.W., and Aso, T. (2008). Mammalian Elongin A complex mediates DNA-damage-induced ubiquitylation and degradation of Rpb1. EMBO J 27, 3256-3266.