Human v-akt murine thymoma viral oncogene homolog 3, PH domain

Target ID:

AKT3A

Aliases:

AKT3DKFZP434N0250PKB-GAMMAPKBGPRKBGRAC-gammaRAC-PK-gammaSTK-2

Deposition Date:

Tuesday 22nd December 2009

Families:

Protein Kinase

Related Diseases:

CancerSignallingNeurobiology

Structure type:

apo

Download Coordinates:

2X18

Authors:

TBA

Site:

Oxford

2X18

tabs

Structure Details

AKT3, the cellular homologue of the murine transforming retrovirus oncogene v-akt, is a member of the AKT, also called PKB (Protein Kinase B), family of serine/threonine protein kinases. Three highly homologous AKT isoforms exist in mammals AKT1 (PKB α), AKT2 (PKB β) and AKT3 (PKB γ) which share about 80 % identity on the amino acid level. AKT kinases are composed of an N-terminal pleckstrin homology (PH) domain, followed by the central catalytic kinase domain and a short regulatory C-terminal tail. The latter is missing in a splice variant of AKT3, termed PKB γ1 (Bellacosa et al., 2004). This splice variant also lacks one of the two regulatory phosphorylation sites, Ser472 in the hydrophobic C-terminal domain. Expression and regulation of PKB γ1 differs from the longer ubiquitously expressed isoform. All AKT kinases are activated in a similar manner: Activation of PI3kinase and subsequent generation of phosphatidylinositol-3,4,5-trisphosphate (PIP3), leads to translocation of AKT to the plasma membrane mediated by the PH domain (Robertson, 2005). Phosphorylation at Thr305 (AKT3) partially activates the kinase whereas for full activation the above mentioned Ser472 must be phosphorylated.

AKT3 is involved in a variety of cellular functions such as cell proliferation, in particular vascular smooth muscle cell proliferation, cell survival, control of mitochondrial biosynthesis and neuroprotection (Sandirasegarane and Kester, 2001), (DeBosch et al., 2006), (Wright et al., 2008), (Kanekura et al., 2005). These functions are corroborated by the phenotypes of the available mouse models for AKT3. Knockout mice for Akt3 show no gross abnormalities but exhibit a 20% decrease in brain size and have smaller and fewer cells in the brain. They have a reduced amount of mitochondria which are increased in size (Easton et al., 2005), (Wright et al., 2008). Transgenic mice specifically overexpressing an activated form of Akt3 that lacks S472 in the heart display marked cardiac hypertrophy and have impaired cardiac contractility. Interestingly, at 4 weeks of age these mice have improved resistance to the cardiotoxic drug doxorubicin, which reverses with age (Taniyama et al., 2005).

AKT3 has been found to be involved in several forms of cancer (Gonzalez and McGraw, 2009). In particular, its role in melanoma has been intensely studied. Decreased activity of PTEN leads to elevated PIP3 levels and activation of AKT3. Furthermore the amount of active AKT3 increases progressively during melanoma tumour progression whereas reduction of AKT3 leads to decreased survival of melanoma cells (Robertson, 2005). In leukemia, interaction of the protooncogene TCL1 with AKT3 via the PH domain enhances AKT3 phosphorylation and activation (Laine et al., 2002). Here we report the structure of the PH domain of AKT3 at 1.46 Å resolution.

Materials and Methods

Entry Clone Source: cDNA Library

Entry Clone Accession: n/a

SGC Construct ID: AKT3A-c040

GenBank GI number: gi|4885549

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Coding DNA sequence:
ATGCACCATCATCATCATCATTCTTCTGG
TGTAGATCTGGGTACCGAGAACCTGTACT
TCCAATCCATGAGCGATGTTACCATTGTG
AAAGAAGGTTGGGTTCAGAAGAGGGGAGA
ATATATAAAAAACTGGAGGCCAAGATACT
TCCTTTTGAAGACAGATGGCTCATTCATA
GGATATAAAGAGAAACCTCAAGATGTGGA
TTTACCTTATCCCCTCAACAACTTTTCAG
TGGCAAAATGCCAGTTAATGAAAACAGAA
CGACCAAAGCCAAACACATTTATAATCAG
ATGTCTCCAGTGGACTACTGTTATAGAGA
GAACATTTCATGTAGATACTCCAGAGGAA
AGGGAAGAATGGACAGAAGCTATCCAGGC
TGTAGCAGACAGACTGCAGAGGCAAGAAG
AGGAGAGAATGAAT

Tags and additions: Cleavable N-terminal His6 tag.

Host: BL21 (DE3)R3-pRARE2

Expressed protein sequence (tag sequence in lowercase):
smSDVTIVKEGWVQKRGEYIKNWRPRYFL
LKTDGSFIGYKEKPQDVDLPYPLNNFSVA
KCQLMKTERPKPNTFIIRCLQWTTVIERT
FHVDTPEEREEWTEAIQAVADRLQRQEEE
RMN

Expression strain: BL-21(DE3)-R3-Rosetta (A homemade phage resistant version of BL21(DE3) containing the pRARE2 plasmid from Rosetta II (DE3) cells).

Transformation: The construct DNA was transformed into homemade chemically competent cells of the expression strain by a standard heat shock procedure.

Glycerol stock preparation: A number of colonies from the transformation were used to inoculate 1 ml of LB media containing 50 µg/ml kanamycin and 34 µg/ml chloramphenicol, which was placed in a 37°C shaker overnight. The next day glycerol stocks were prepared from this overnight culture.

Expression: A glycerol stock was used to inoculate 50 ml of LB media containing 50 µg/ml kanamycin and 34 µg/ml chloramphenicol, which was placed in a 37°C shaker overnight. The next day this starter culture was used to inoculate 2x 1L of LB media (18 ml starter culture into each) containing 33 µg/ml kanamycin. After 3 hours the temperature was reduced to 18°C. After a further 30 minutes the cells were induced by the addition of 0.5 mM IPTG. The expression was continued overnight.

Cell harvest: Cells were spun at 6238x g for 10 mins at 4°C. The cells were resuspended in 30 ml of Lysis Buffer with the addition of 0.2 mM PMSF. The resuspended cell pellet was placed in a -80°C freezer.

Lysis Buffer: 50 mM Hepes pH 7.4, 500 mM NaCl, 5% Glycerol, 5 mM Imidazole pH 7.4, 0.5 mM TCEP

Cell Lysis: The resuspended cell pellet was lysed by sonication. PEI (polyethyleneimine) was added to a final concentration of 0.15 % and the cell debris and precipitated DNA were spun down (17000 rpm, JA17 rotor, 45 min).

Column 1: Ni-NTA (2 ml volume in a gravity-flow column).

Buffers:
Binding Buffer: 50 mM Hepes pH 7.4, 500 mM NaCl, 5% Glycerol, 5 mM Imidazole pH 7.4, 0.5 mM TCEP
Wash Buffer: 50 mM Hepes pH 7.4, 500 mM NaCl, 5% Glycerol, 25 mM Imidazole pH 7.4, 0.5 mM TCEP
Elution Buffer: 50 mM Hepes pH 7.4, 500 mM NaCl, 5% Glycerol, 250 mM Imidazole pH 7.4, 0.5 mM TCEP

Procedure: The clarified cell extract was passed through the column. The column was then washed with Binding Buffer (50 ml) and Wash Buffer (25 ml). The protein was eluted with 10 ml of Elution Buffer.

Column 2: S200 16/60 Gel Filtration.

Buffers:
GF Buffer: 25 mM Hepes pH 7.4, 500 mM NaCl, 0.5 mM TCEP

Procedure: The elution buffer fraction from column 1 was concentrated to 4 ml volume in a 10 kDa MW cutoff spin concentrator. The concentrated sample was injected onto an S200 16/60 column ( pre-equilibrated in GF Buffer ) at 1.0 ml/min. 1.75 ml fractions were collected.

TEV protease digestion: Gel filtration fractions containing AKT3A PH domain were combined. TEV protease was added and the sample left at 4°C over the weekend.

Rebinding of impurities to Ni-NTA: The protein was passed through a gravity-flow column containing Ni-NTA resin (2 ml resin volume, pre-equilibrated into GF Buffer), eluting with GF buffer containing 10 mM imidazole.

Concentration: The TEV protease cleaved protein was concentrated to 12.5 mg/ml (measured by 280 nm absorbance), distributed into aliquots and frozen at -80°C.

Mass spectrometry characterization (ESI-MS): Measured: 14268.8; Expected: 14268.3

Crystallisation: Crystals grew from a 1:1 ratio of protein to precipitant solution (0.2 M proline; 0.1M HEPES pH 7.5; 10% PEG 3350), using the vapour diffusion method. Crystals were cryo-protected by equilibration with 50% PEG3350 mixed 1:1 with reservoir solution and 1µl added into precipitant solution, and then flash frozen in liquid nitrogen.

Data Collection: Resolution: 1.54 Å; X-ray source: Diamond Synchrotron, Beamline I04.

References

Bellacosa, A., Testa, J.R., Moore, R., and Larue, L. (2004). A portrait of AKT kinases: human cancer and animal models depict a family with strong individualities. Cancer Biol Ther 3, 268-275.
DeBosch, B., Sambandam, N., Weinheimer, C., Courtois, M., and Muslin, A.J. (2006). Akt2 regulates cardiac metabolism and cardiomyocyte survival. J Biol Chem 281, 32841-32851.
Easton, R.M., Cho, H., Roovers, K., Shineman, D.W., Mizrahi, M., Forman, M.S., Lee, V.M., Szabolcs, M., de Jong, R., Oltersdorf, T., et al. (2005). Role for Akt3/protein kinase Bgamma in attainment of normal brain size. Mol Cell Biol 25, 1869-1878.
Gonzalez, E., and McGraw, T.E. (2009). The Akt kinases: isoform specificity in metabolism and cancer. Cell Cycle 8, 2502-2508.
Kanekura, K., Hashimoto, Y., Kita, Y., Sasabe, J., Aiso, S., Nishimoto, I., and Matsuoka, M. (2005). A Rac1/phosphatidylinositol 3-kinase/Akt3 anti-apoptotic pathway, triggered by AlsinLF, the product of the ALS2 gene, antagonizes Cu/Zn-superoxide dismutase (SOD1) mutant-induced motoneuronal cell death. J Biol Chem 280, 4532-4543.
Laine, J., Kunstle, G., Obata, T., and Noguchi, M. (2002). Differential regulation of Akt kinase isoforms by the members of the TCL1 oncogene family. J Biol Chem 277, 3743-3751.
Robertson, G.P. (2005). Functional and therapeutic significance of Akt deregulation in malignant melanoma. Cancer Metastasis Rev 24, 273-285.
Sandirasegarane, L., and Kester, M. (2001). Enhanced stimulation of Akt-3/protein kinase B-gamma in human aortic smooth muscle cells. Biochem Biophys Res Commun 283, 158-163.
Taniyama, Y., Ito, M., Sato, K., Kuester, C., Veit, K., Tremp, G., Liao, R., Colucci, W.S., Ivashchenko, Y., Walsh, K., et al. (2005). Akt3 overexpression in the heart results in progression from adaptive to maladaptive hypertrophy. J Mol Cell Cardiol 38, 375-385.
Wright, G.L., Maroulakou, I.G., Eldridge, J., Liby, T.L., Sridharan, V., Tsichlis, P.N., and Muise-Helmericks, R.C. (2008). VEGF stimulation of mitochondrial biogenesis: requirement of AKT3 kinase. FASEB J 22, 3264-3275.