Human receptor activity modifying protein 2 (extracellular domain)

Target ID:

RAMP2A

Aliases:

RAMP2

Deposition Date:

Sunday 31st October 2010

Families:

Miscellaneous

Related Diseases:

Cancer

Structure type:

apo

Download Coordinates:

2XVT

Authors:

A. Quigley., A. C. W. Pike., N. Burgess-Brown., T. Krojer., L. Shrestha., S. Goubin., J. Kim., S. Das., J. R. C. Muniz., P. Canning., A. Chaikuad., F. von Delft., C. H. Arrowsmith., J. Weigelt., A. M. Edwards., C. Bountra., A. J. Barr., E. P. Carpenter.

Site:

Oxford

2XVT

tabs

Structure Details

RAMPs (receptor activity modifying proteins) are a family of single-pass type I transmembrane proteins consisting of three members, RAMP1-3, in humans. RAMPs are composed of a ~100 residue N-terminal extracellular domain, a single transmembrane helix and a seven residue cytoplasmic C-terminus. In Addition they have a predicted cleavable signal sequence of ~26 to ~44 amino acids at their N-termini. RAMPs associate with 7-transmembrane helix G-protein coupled receptors (GPCRs) of the class B family, in particular the calcitonin-receptor-like receptor (CL) and the calcitonin receptor (CTR) to generate a variety of composite receptors. The N-terminus thereby determines receptor pharmacology whereas the C-terminus and the transmembrane region are important for intracellular signalling and receptor interaction, respectively (Qi and Hay, 2010) (Brain and Grant, 2004).

RAMP2 associates with CL to form the Adrenomedullin receptor (Hay et al., 2004). It regulates the transport of CL to the plasma membrane and determines specificity for adrenomedullin, a vasodilator and key regulator of angiogenesis, vascular integrity and cell migration (Fernandez-Sauze et al., 2004) (Fukai et al., 2003). Disturbance of these functions are obvious in the RAMP2 knockout mice, which die in utero due to vascular fragility resulting in severe oedema and haemorrhage. Heterozygous mice exhibit decreased litter size beyond the loss of homozygous embryos and show vascular hyperpermeability as well as impaired neovascularization (Ichikawa-Shindo et al., 2008).

RAMP2 associates with CTR to form the amylin receptor (AMY2) (Hay et al., 2004) and it interacts with the vasoactive intestinal polypeptide/pituitary adenylate cyclase-activating peptide receptor, the glucagon and parathyroid hormone receptors (Christopoulos et al., 2003). Little is known about the physiological role of these receptor dimers.

Expression of RAMP2 and adrenomedullin are increased in cardiac hypertrophy and during heart failure. The increase in expression levels of both proteins exerts a cardioprotective role by attenuating cardiomyocyte hypertrophy and fibroblast activation (Oie et al., 2005).

The role of adrenomedullin in cancer is well established and therapeutic approaches to target adrenomedullin receptors are under way (Dai et al., 2010) (Kaafarani et al., 2009). In addition, expression of RAMP2 is frequently silenced by methylation in lung cancer (Yue et al., 2007). Here we describe the structure of RAMP2 extracellular domain at 2.0 Å.

Materials and Methods

Entry Clone Source: MGC

Entry Clone Accession: IMAGE:5229167

SGC Construct ID: RAMP2A-c405

GenBank GI number: gi|5032021

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified construct sequence:
CATATGCACCATCATCATCATCATTC
TTCTGGTGTAGATCTGGGTACCGAGA
ACCTGTACTTCCAATCCATGACAGGC
ACACCAGGGTCAGAAGGGGGGACGGT
GAAGAACTATGAGACAGCTGTCCAAT
TTTGCTGGAATCATTATAAGGATCAA
ATGGATCCTATCGAAAAGGATTGGTG
CGACTGGGCCATGATTAGCAGGCCTT
ATAGCACCCTGCGAGATTGCCTGGAG
CACTTTGCAGAGTTGTTTGACCTGGG
CTTCCCCAATCCCTTGGCAGAGAGGA
TCATCTTTGAGACTCACCAGATCCAC
TTTGCCAACTGCTCCCTGGTGCAGCC
CACCTTCTCTTGACAGTAAAGGTGGA
TACGGATCCGAA

Final protein sequence (Tag sequence in lowercase):
mhhhhhhssgvdltenlyfq^SMTGT
PGSEGGTVKNYETAVQFCWNHYKDQM
DPIEKDWCDWAMISRPYSTLRDCLEH
FAELFDLGFPNPLAERIIFETHQIHF
ANCSLVQPTFS

^ TEV cleave site

Tags and additions: Cleavable N-terminal His6 tag

Host: BL21 (DE3) R3-pRARE2 (Phage resistant strain).

Growth medium, induction protocol: 5ml from an overnight culture containing 50µg/ml kanamycin & 34µg/ml chloramphenicol was used to inoculate each 1L culture of LB. Cultures were grown at 37°C until the OD₆₀₀ reached ~1.8 then the temperature was adjusted to 20°C. Expression was induced using 0.5mM IPTG added at an OD₆₀₀ of ~2.0 and the cells were grown overnight. the cells were collected by centrifugation, and the pellet was resuspended in binding buffer and frozen. For selenomethionine labeling of protein, 50ml of an overnight culture was washed with methionine minus medium (Molecular Dimensions Ltd) and used to inoculate 8L of methionine minus medium supplemented with 40mg/L of L-selenomethionine (Acros Organics) containing 50µg/ml kanamycin & 34µg/ml chloramphenicol. Protein expression was induced as above for the native protein.
Binding buffer: 50 mM HEPES pH 7.5; 500mM NaCl.
Extraction method: Frozen pellets were thawed and cells lysed with 3 passes through a C3 high pressure cell disrupter (Avestin). The lysate was centrifuged at 17,000 rpm for 30 minutes and pellet was retained for purification. The pellet was solubilized in solubilization buffer using a Telfon homogenizer followed by mixing on a rotating platform for 1 hour at room temperature. The solubilized lysate was centrifuged at 17,000 rpm for 30 minutes and the supernatant collected for purification.

Solubilization buffer: 25 mM HEPES, pH 7.5; 8 M Urea; 1 M NaCl; 5 mM imidazole and 0.5 mM TCEP.

Column 1: Ni-affinity. Nickel-IDA (Sterogene), 5ml of 50% slurry in 1.5 x 10cm column, washed with binding buffer.

Column 1 Buffer:
Solubilization buffer: 25 mM HEPES, pH 7.5; 8 M Urea; 1 M NaCl; 5 mM imidazole and 0.5 mM TECP.
Wash Buffer: 25 mM HEPES, pH 7.5; 8 M Urea; 1 M NaCl; 30 mM imidazole and 0.5 mM TCEP.
Elution Buffer: 25 mM HEPES, pH 7.5; 8 M Urea; 1 M NaCl; 50 to 400 mM imidazole and 0.5 mM TCEP.

Column 1 Procedure: The solubilized lysate was loaded by gravity flow on the Ni-IDA column. The column was then washed with 100ml solubilization buffer and 100ml of wash buffer. The protein was eluted by applying 10ml portions of elution buffer with increasing concentration of imidazole (50, 150, 250 and 400 mM); fractions were collected until essentially all protein was eluted.

Protein Refolding: Eluted protein was transferred to dialysis tubing (3 kDa cut-off) and dialysed against 2L of refolding buffer overnight at 4°C, followed by a further 8 hours dialysis in fresh refolding buffer. The protein was then dialysed overnight against 1L of dialysis buffer overnight at 4°C.

Buffers:
Refolding buffer: 50 mM Na phosphate pH 8.0; 0.5 M arginine; 2.5 mM reduced glutathione; 0.5 mM oxidised glutathione and 1 mM EDTA.
Dialysis buffer: 20 mM Tris-HCL pH 7.3; 50 mM NaCl; 1 mM EDTA; 10% glycerol.

Enzymatic treatment: 0.1mg of TEV protease was added overnight at 4°C to the refolded protein to cleave the Tag. Cleaved protein was buffer exchanged to 20 mM Tris-HCl pH 7.3, 50 mM NaCl using a PD-10 column and TEV protease was removed by binding to Ni-IDA.

Column 2: Size Exclusion Chromatography. Superdex S75 16/60 HiLoad

Column 2 Buffers: 20 mM Tris-HCl pH 7.3, 50 mM NaCl.

Column 2 Procedure: The protein was concentrated and applied to an S75 16/60 HiLoad gel filtration column equilibrated in 20 mM Tris-HCl pH 7.3, 50 mM NaCl using an ÄKTAxpress system.

Mass spectrometry characterization: LC-ESI MS TOF analysis indicated the purified protein had a mass of 10859.6 Da. The measured mass is in accordance with the expected native mass (10863 Da) with the loss of 4 Da as a result of formation of 2 disulphide bonds. Selenomethionine labeled protein had a mass of 11000.6 Da.

Protein concentration: Protein was concentrated to 10mg/ml using a 3 kDa cut-off concentrator (Amicon).

Crystallisation:
Native: Crystals were grown at 20°C in 300nl sitting drops comprising a 1:1 ratio of protein (14mg/ml) to reservoir solution containing 0.1M CaCl₂; 26% v/v PEG monomethylether 350; 0.1M HEPES pH 7.5. Similar crystals were also obtained with similar concentrations of PEG400.
Selenomethionine-substituted: Crystals were grown at 20° in 150nl sitting drops comprising a 2:1 ratio of protein (8.7mg/ml) to reservoir solution containing 2.4M sodium malonate. In both cases, the sitting drops were seeded with 20nl of a solution of native crystals.

Data Collection: Crystals were vitrified directly in liquid nitrogen. High resolution native data, extending to 2.05 Å resolution, were obtained from unsubstituted crystals collected on beamline I02 at Diamond Light Source (λ=0.9795Å). A three-wavelength 2.9Å MAD dataset was also collected from crystals grown with selenomethionine-substituted protein on beamline I03. Experimental phases were obtained from datasets collected at the selenomethionine peak wavelength (λ=0.9803Å), inflection point (λ=0.9806Å) and high energy remote (λ=0.9763Å).

Structure Solution: A total of 12 selenium sites were located (corresponding to six RAMP2 molecules in the crystallographic asymmetric unit) and refined using AUTOSHARP. initial maps allowed the tracing of the entire RAMP2 ECD. Phases were transferred to the native dataset using multi-crystal, six-fold averaging (DMMULTI). Initial model building was carried out using BUCCANEER and completed by hand.

Resolution: 2.05Å

References

Brain, S.D., and Grant, A.D. (2004). Vascular actions of calcitonin gene-related peptide and adrenomedullin. Physiol Rev 84, 903-934.
Christopoulos, A., Christopoulos, G., Morfis, M., Udawela, M., Laburthe, M., Couvineau, A., Kuwasako, K., Tilakaratne, N., and Sexton, P.M. (2003). Novel receptor partners and function of receptor activity-modifying proteins. J Biol Chem 278, 3293-3297.
Dai, X., Ma, W., Jha, R.K., and He, X. (2010). Adrenomedullin and its expression in cancers and bone. A literature review. Front Biosci (Elite Ed) 2, 1073-1080.
Dai, X., Ma, W., Jha, R.K., and He, X. (2010). Adrenomedullin and its expression in cancers and bone. A literature review. Front Biosci (Elite Ed) 2, 1073-1080.
Fukai, N., Shichiri, M., Ozawa, N., Matsushita, M., and Hirata, Y. (2003). Coexpression of calcitonin receptor-like receptor and receptor activity-modifying protein 2 or 3 mediates the antimigratory effect of adrenomedullin. Endocrinology 144, 447-453.
Hay, D.L., Christopoulos, G., Christopoulos, A., and Sexton, P.M. (2004). Amylin receptors: molecular composition and pharmacology. Biochem Soc Trans 32, 865-867.
Ichikawa-Shindo, Y., Sakurai, T., Kamiyoshi, A., Kawate, H., Iinuma, N., Yoshizawa, T., Koyama, T., Fukuchi, J., Iimuro, S., Moriyama, N., et al. (2008). The GPCR modulator protein RAMP2 is essential for angiogenesis and vascular integrity. J Clin Invest 118, 29-39.
Kaafarani, I., Fernandez-Sauze, S., Berenguer, C., Chinot, O., Delfino, C., Dussert, C., Metellus, P., Boudouresque, F., Mabrouk, K., Grisoli, F., et al. (2009). Targeting adrenomedullin receptors with systemic delivery of neutralizing antibodies inhibits tumor angiogenesis and suppresses growth of human tumor xenografts in mice. FASEB J 23, 3424-3435.
Oie, E., Vinge, L.E., Andersen, G.O., Yndestad, A., Krobert, K.A., Sandberg, C., Ahmed, M.S., Haug, T., Levy, F.O., Skomedal, T., et al. (2005). RAMP2 and RAMP3 mRNA levels are increased in failing rat cardiomyocytes and associated with increased responsiveness to adrenomedullin. J Mol Cell Cardiol 38, 145-151.
Qi, T., and Hay, D.L. Structure-function relationships of the N-terminus of receptor activity-modifying proteins. Br J Pharmacol 159, 1059-1068.
Yue, W., Dacic, S., Sun, Q., Landreneau, R., Guo, M., Zhou, W., Siegfried, J.M., Yu, J., and Zhang, L. (2007). Frequent inactivation of RAMP2, EFEMP1 and Dutt1 in lung cancer by promoter hypermethylation. Clin Cancer Res 13, 4336-4344.