Human transglutaminase 1 beta-barrel domain

Target ID:

TGM1A

Aliases:

ICR2KTGLILI1TGASETGKTGM1

Deposition Date:

Tuesday 30th November 2010

Families:

Miscellaneous

Related Diseases:

CancerMetabolism

Structure type:

apo

Download Coordinates:

2XZZ

Authors:

M.Vollmar, E.Krysztofinska,T.Krojer,W.W.Yue,C.Cooper,K.Kavanagh, C. Allerston, A. Chaikuad,F. von Delft, C.Arrowsmith,J.Weigelt,A.Edwards,C.Bountra,U.Oppermann

Site:

Oxford

2XZZ

tabs

Structure Details

Transglutaminases (TGM, EC 2.3.2.13) are a family of Ca2+-dependent enzymes ubiquitous in mammalian cells, responsible for the cross-linking reactions between glutamine and lysine residues in proteins (Lorand and Graham, 2003). They catalyze an acyl-transfer reaction between the γ-carboxamide group from protein-bound glutamine residues (acyl donor) and the ε-amino group of protein-bound lysine residues or other primary amines (acyl acceptor), to form an intra- or inter-molecular Nε-(γ-glumamyl)-lysyl covalent bond. This crosslinking generates protein polymers that confer stability and resistance on biomolecules.

The TGM protein family consists of 9 distinct members in mammals which are involved in multiple cellular processes. Among them, transglutaminase 1 (TGM1; keratinocyte transglutaminase) and transglutaminase 2 (TGM2; tissue transglutaminase) have been extensively characterized. TGM1 is essential for keratinocyte differentiation in the epidermis [2] and its substrates include the structural proteins loricrin, involucrin and small proline-rich proteins (SPR) that are primary components of the cell envelope structure. TGM2 is the most ubiquitous member of the TGM family, and has a crucial role during development, apoptosis and cell differentiation [3]. The levels of TGM1/TGM2 expression and activity have also been shown to be elevated in Alzheimer's and Parkinson's diseases.

Mutations in the TGM1 gene at chromosome location 14q11.2 are the cause of lamellar ichthyosis (LI; OMIM 242300), a rare congenital disorder of keratinization with an incidence of 1:250000. LI is often present at birth with severe ichthyosis of the skin without manifestations in other organs. Despite many years of study, a correlation of the genotype-phenotype relationship in LI has not been fully elucidated, partly due to a lack of biochemical and structural data on the human protein. Human TGM1 is a 90 kDa polypeptide anchored to the cytoplasmic side of the plasma membrane via a thioester linkage. It is a multi-domain protein with a catalytic core encased by two β-barrel domains and one β-sandwich domain. We have determined the crystal structure of a human TGM1 β-barrel domain at 2.3 Å resolution. Further structural work to characterize longer constructs of TGM1 is currently underway.

Materials and Methods

Entry Clone Source: MGC

Entry Clone Accession: IMAGE:4747045

SGC Construct ID: TGM1A-c116

GenBank GI number: gi|4507475

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified construct sequence:
CATATGCACCATCATCATCATCATTC
TTCTGGTGTAGATCTGGGTACCGAGA
ACCTGTACTTCCAATCCATGCTCTCC
CTCACGTTACTGGGAGCAGCAGTGGT
TGGCCAGGAGTGTGAAGTACAGATTG
TCTTCAAGAACCCCCTTCCCGTCACC
CTCACCAATGTCGTCTTCCGGCTCGA
AGGCTCTGGGTTACAGAGGCCCAAGA
TCCTCAACGTTGGGGACATTGGAGGC
AATGAAACAGTGACACTGCGCCAGTC
GTTTGTGCCTGTGCGACCAGGCCCCC
GCCAGCTCATTGCCAGCTTGGACAGC
CCACAGCTCTCCCAGGTGCACGGTGT
CATCCAGGTGGATGTGGCCTAACAGT
AAAGGTGGATACGGATCCGAA

Final protein sequence (Tag sequence in lowercase):
mhhhhhhssgvdlgtenlyfq^smLS
LTLLGAAVVGQECEVQIVFKNPLPVT
LTNVVFRLEGSGLQRPKILNVGDIGG
NETVTLRQSFVPVRPGPRQLIASLDS
PQLSQVHGVIQVDVA

^ TEV cleave site

Tags and additions: N-terminal TEV cleavable His6 tag.

Host: BL21 (DE3)R3-pRARE2 (Phage resistant strain).

Growth medium, induction protocol: 10µl of glycerol stock of host strain BL21(DE3)-R3-pRARE2 was used to inoculate 100ml of TB (Terrific Broth) supplemented with 50µg/ml kanamycin. This starter culture was grown overnight at 37°C and used next day to inoculate 8L TB (5ml starter culture per 1 litre) containing 50µg/ml kanamycin. The culture was grown at 37°C until the OD₆₀₀ reached ~1. After that the temperature was lowered to 18° and protein production was induced by addition of 0.1 mM IPTG. The expression was continued overnight at that temperature. The next day cells were harvested by centrifugation at 4000 rpm for 20 minutes at 4°C then the supernatant was discarded and pellets resuspended in binding buffer and stored at -80°C.
Lysis buffer: 50 mM HEPES pH 7.5; 500 mM NaCl; 5% Glycerol; 10 mM Imidazole, pH 7.5; 0.5 mM TCEP; 1 mM PMSF.
Extraction buffer, extraction method: Frozen cells, previously resuspended, were thawed, and supplemented with benzonase (25U/ml, 2µl of benzonase per 50ml of buffer). Cells were passed 4 times through an Emulsiflex C5 high-pressure homogeniser, collected and centrifuged for 60 min at 15500 rpm (Beckman JLA 16.25).

Column 1: Ni-sepharose, HisTrap FF, 5ml (GE healthcare).

Column 1 Buffer:
Wash Buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 40 mM Imidazole; 5% glycerol; 1 mM PMSF; 0.5 mM TCEP.
Elution Buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% Glycerol; 250 mM Imidazole; 0.5 mM TCEP.

Column 1 Procedure: The cell extract was loaded onto 2x5ml Ni-sepharose columns at 4ml/minute on an ÄKTA Express system (GE healthcare). The columns were then washed with 20 column volumes of binding buffer, 10 column volumes of wash buffer, and then eluted with 5 column volumes of elution buffer at 5ml/min. The eluted peak of A₂₈₀ was autmatically collectd.

Column 2: Gel filtration. HisLoad S200 16/60.

Column 2 Buffers: 10 mM HEPES, pH 7.5; 500 mM NaCl; 5% glycerol; 0.5 mM TCEP.

Column 2 Procedure: The eluted fractions from Ni-sepharose were automatically loaded on the gell filtration column pre-equilibrated in GF buffer at 1.2ml/min. Eluted proteins were collected in 1.8ml fractions and analysed by SDS-PAGE.

Enzymatic treatment: Fractions containing TGM1A were pooled and 1mg of TEV protease was added per 45mg protein. The digestion was performed overnight at 4°C. The following day protein sample was loaded onto Ni-sepharose column (1ml slurry) pre-equilibrated with GF buffer to remove uncleaved protein. The flow-through and wash fractions were pooled and concentrated using Amicon Ultra-15 concentrators with 10kDa cutoff.

Protein concentration: Protein was concentrated to 12mg/ml and frozen at -80°C.

Mass spectrometry characterization:
Measured: 12793.7 Da (ESI-MS).
Expected: 12793.7 Da
Mass spec analysis reveals that the purified fractions contain both tag-cleaved and uncleaved protein.

Crystallisation: Crystals were grown at 20°C by vapour diffusion in sitting drops mixing protein (12mg/ml) and well solution containing 0.7M ammonium sulphate, 1% (v/v) PEG3350, 0.1 M BTS-TRIS pH 5.5 at a protein to precipitant ratio of 2:1. Crystals were cryo-protected using 25% (v/v) ethylene glycol supplemented to the well solution and flash cooled in liquid nitrogen.

Data Collection:
Resolution: 2.3 Å
X-ray source: Diamond Light Source beamline I04.

References

L. Lorand and R.M. Graham (2003). Transglutaminases: crosslinking enzymes with pleiotropic functions, Nat Rev Mol Cell Biol 4, pp. 140?156.
R.L. Eckert, M.T. Sturniolo, A.M. Broome, M. Ruse and E.A. Rorke (2005). Transglutaminase function in epidermis, J Invest Dermatol 124, pp. 481?492.
L. Fesus (1993). Biochemical events in naturally occurring forms of cell death, FEBS Lett. 328, pp. 1?5.