Human Actin-binding protein anillin (PH domain)

Target ID:

ANLNA

Deposition Date:

Monday 31st January 2011

Families:

Miscellaneous

Structure type:

apo

Download Coordinates:

2Y7B

Authors:

M.Vollmar, J.Wang, T.Krojer, J.Elkins, P.Filippakopoulos, E.Ugochukwu, R.Cocking, F.Von Delft, C.Bountra, C.H.Arrowsmith, J.Weigelt, A.Edwards, S.Knapp

Site:

Oxford

2Y7B

tabs

Structure Details

The name "Anillin" is derived from the Spanish word anillo, meaning ring, due to its enrichment in the contractile ring throughout cytokinesis (Zhang and Maddox, 2010). Anillin is highly conserved and consists of an N-terminal myosin/actin binding domain, a central anillin homology domain as well as a C-terminal PH domain (Piekny and Maddox, 2010). Anillins are scaffolding proteins that regulate primarily cortical cytoskeletal dynamics during cytokinesis and cellularization. The protein has been discovered in Drosophila melanogaster as an F-actin-binding protein which localizes to the nucleus during interphase and to the contractile ring during cytokinesis (Field and Alberts, 1995). Anillin is also highly enriched at the leading edge of the Drosophila embryo cellularization front and in nascent ring canals in the ovary. The Anillin orthologue in S. pombe (Mid1p) has been shown to be hyperphosphorylated during interphase but kinases that specifically target anillin have not been indentified so far. In human, anillin recruitment to the equatorial cortex depends on RhoA activity but is independent of downstream Rho signalling partners (Chartier et al., 2011) (Silverman-Gavrila et al., 2008). After mitotic exit, anillin is rapidly degraded by the anaphase-promoting complex/cyclosome (APC/C) (Hickson and O'Farrell, 2008).

Due to its central role in cell division, anillin is critical for development and homeostasis. Anillin expression levels correlate with metastatic potential of human tumours from many different tissue origins. Inhibition of anillin expression suppressed the growth of lung cancer cells in culture. Over-expression in cancer may increase cell motility, and thus directly contribute to cancer progression. Here we present the structure of the PH domain of human anillin at 1.9Å resolution.

Materials and Methods

Entry Clone Source: MGC

Entry Clone Accession: IMAGE:4825802

SGC Construct ID: ANLNA-c002

GenBank GI number: gi|31657094

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified construct sequence:
ATGCACCATCATCATCATCATTCTTC
TGGTGTAGATCTGGGTACCGAGAACC
TGTACTTCCAATCCATGAAATGTCAA
GTGAATTCCAGTGTTGAAGAAAGAGG
TTTTCTAACCATATTTGAAGATGTTA
GTGGTTTTGGTGCCTGGCATCGAAGA
TGGTGTGTTCTTTCTGGAAACTGTAT
ATCTTATTGGACTTATCCAGATGATG
AGAAACGCAAGAATCCCATAGGAAGG
ATAAATCTGGCTAATTGTACCAGTCG
TCAGATAGAACCAGCCAACAGAGAAT
TTTGTGCAAGACGCAACACTTTTGAA
TTAATTACTGTCCGACCACAAAGAGA
AGATGACCGAGAGACTCTTGTCAGCC
AATGCAGGGACACACTCTGTGTTACC
AAGAACTGGCTGTCTGCAGATACTAA
AGAAGAGCGGGATCTCTGGATGCAAA
AACTCAATCAAGTTCTTGTTGATATT
CGCCTCTGGCAACCTGATGCTTGCTA
CAAATGA

Final protein sequence (Tag sequence in lowercase):
smKCQVNSSVEERGFLTIFEDVSGFG
AWHRRWCVLSGNCISYWTYPDDEKRK
NPIGRINLANCTSRQIEPANREFCAR
RNTFELITVRPQREDDRETLVSQCRD
TLCVTKNWLSADTKEERDLWMQKLNQ
VLVDIRLWQPDACYK

(Lys977 to Lys1119)

The N-terminal residues, sm, derive from the vector following TEV protease digestion to remove the expression tag.

Tags and additions: N-terminal, TEV cleavable hexahistidine tag.

Host: BL21 (DE3)R3-pRARE2 (Phage resistant strain).

Growth medium, induction protocol: The construct DNA was transformed into homemade chemically competent cells of the expression strain by a standard heat shock procedure. A number of colonies from the transformation were used to inoculate 1ml of LB media containing 50µg/ml kanamycin and 34µg/ml chloramphenicol, which was placed in a 37°C shaker overnight. The next day glycerol stocks were prepared from this overnight culture. A glycerol stock was used to inoculate 40ml of LB media containing 50µg/ml kanamycin and 34µg/ml chloramphenicol, which was placed in a 37°C shaker overnight. The next day 2x15ml of this starter culture was used to inoculate 2x1L of LB media containing 40µg/ml kanamycin in 2x2L baffled shaker flasks. When the OD₆₀₀ was approximately 1.0, the temperature was reduced to 18°C and the cells were induced by the addition of 0.5mM IPTG. The expression was continued overnight. Cells were spun at 5500rpm for 10 mins and the pellets resuspended in Lysis Buffer and then frozen at -20°C.
Lysis buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% Glycerol; 5 mM Imidazole; 0.5 mM TCEP.
Extraction buffer, extraction method: The resuspended cell pellet was thawed and lysed by sonication. The sample was diluted to 90ml volume and PEI (polyethyleneimine) was added to a final concentration of 0.15%. The cell debris and precipitated DNA were spun down (18000rpm, JA18 rotor, 60 min).

Column 1: 2ml of Ni-NTA in a 1cm diameter gravity flow column.

Column 1 Buffers:
Binding Buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% glycerol; 5 mM Imidazole; 0.5 mM TCEP.
Wash Buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% glycerol; 25 mM Imidazole; 0.5 mM TCEP.
Elution Buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% glycerol; 250 mM Imidazole; 0.5 mM TCEP.

Column 1 Procedure: The clarified supernatant was passed through the column. The column was washed with 50ml of binding Buffer and 25ml of Wash Buffer. 10ml of Elution Buffer was passed through to elute the protein.

Column 2: S200 16/60 Gel Filtration

Column 2 Buffer: 25 mM HEPES, pH 7.5; 150 mM NaCl; 0.5 mM TCEP.

Column 2 Procedure: The eluted protein was concentrated to 5ml volume and injected onto an S200 16/60 GF column (pre-equilibrated in GF buffer) at 1.0 ml/min. 1.75ml fractions were collected.

Enzymatic treatment: The gel filtration fractions containing ANLNA were pooled. TEV protease was added and the sample left overnight at 4°C. The digested sample was passed through a 0.5cm diameter column containing 2ml of Ni-NTA (pre-equilibrated in GF Buffer). The resin was eluted with a further 10ml of GF Buffer containing 10 mM Imidazole.

Protein concentration: The sample was concentrated to 19mg/ml (measured by 280nm absorbance), distributed into aliquots and frozen at -80°C.

Mass spectrometry characterization:
Measured: 17220 (+80)
Expected: 17140.5

Crystallisation: Crystals grew from a 2:1 ratio of 6mg/ml protein and precipitant solution (20% PEG3350, 0.1M BisTris pH 5.5, 4% acetonitrile), using the vapour diffusion method. Seeds from crushed ANLNA crystals were added to enhance crystal size.

Data collection: Crystals were cryo-protected by equilibration into precipitant solution containing 25% ethylene glycol, and then flash frozen in liquid nitrogen. Data was collected at Diamond beamline I02.

References

Chartier, N.T., Salazar Ospina, D.P., Benkemoun, L., Mayer, M., Grill, S.W., Maddox, A.S., and Labbe, J.C. (2011). PAR-4/LKB1 Mobilizes Nonmuscle Myosin through Anillin to Regulate C. elegans Embryonic Polarization and Cytokinesis. Curr Biol.
Field, C.M., and Alberts, B.M. (1995). Anillin, a contractile ring protein that cycles from the nucleus to the cell cortex. J Cell Biol 131, 165-178.
Hickson, G.R., and O'Farrell, P.H. (2008). Anillin: a pivotal organizer of the cytokinetic machinery. Biochem Soc Trans 36, 439-441.
Piekny, A.J., and Maddox, A.S. (2010). The myriad roles of Anillin during cytokinesis. Semin Cell Dev Biol 21, 881-891.
Silverman-Gavrila, R.V., Hales, K.G., and Wilde, A. (2008). Anillin-mediated targeting of peanut to pseudocleavage furrows is regulated by the GTPase Ran. Mol Biol Cell 19, 3735-3744.
Zhang, L., and Maddox, A.S. (2010). Anillin. Curr Biol 20, R135-136.