Human ligand of numb-protein X

Target ID:

LNX1A

Aliases:

LNXLNX1MPDZPDZRN2

Deposition Date:

Tuesday 30th October 2007

Families:

Linkers

Structure type:

apo

Download Coordinates:

3B76

Authors:

Ugochukwu, E., Burgess-Brown, N., Berridge, G., Elkins, J., Bunkoczi, G., Pike, A. C. W., Sundstrom, M., Arrowsmith, C. H., Weigelt, J., Edwards, A., Gileadi, O., von Delft, F., Doyle, D.

Site:

Oxford

3B76

tabs

Structure Details

PDZ domains function as protein-protein interaction modules. The best characterised interaction of the PDZ domain is with the C-terminal 4-5 residues of the target protein that binds in an extended fashion between the betaB strand and the alphaB helix of the PDZ domain. In many cases the protein that contains the PDZ domain also possesses additional PDZ domains or interaction modules. Ligand of numb-protein X (LNX1) is one such protein in that it contains a total of four PDZ domains.

Numb is a phosphotyrosine-binding (PTB) domain-containing protein that determines cell fate during neural system development. As its name indicates LNX1 forms a complex with numb (Dho et al, 1998). As well as being important in neurogenesis it also plays a role in neuronal degeneration (Lim et al, 2006) and potentially tumorigenesis (Chen et al, 2005).

The PDZ domains have been shown to interact with other LNX family members (Rice et al, 2001), Ski interacting protein (Chen et al, 2005) and more specifically the 2nd PDZ domain with the C-terminus from the coxsackievirus and adenovirus receptor (Sollerbrant et al, 2003). Here we show through structural analysis that the the 3rd PDZ domain of LNX1 is also capable of binding the four C-terminal residues (-Gly-Ser-Ile-Val-COO-) of the coxsackievirus and adenovirus receptor.

Materials and Methods

Entry Clone Source: MGC

Entry Clone Accession: IMAGE:5194423

SGC Construct ID: LNX1A-c062

GenBank GI number: gi|14249128

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified construct sequence:
ATGCACCATCATCATCATCATTCTTCTGG
TGTAGATCTGGGTACCGAGAACCTGTACT
TCCAATCCATGCATGAGAAGGTGGTAAAT
ATCCAAAAAGACCCCGGTGAATCTCTCGG
CATGACCGTCGCAGGGGGAGCATCACATA
GAGAATGGGATTTGCCTATCTATGTCATC
AGTGTTGAGCCCGGAGGAGTCATAAGCAG
AGATGGAAGAATAAAAACAGGTGACATTT
TGTTGAATGTGGATGGGGTCGAACTGACA
GAGGTCAGCCGGAGTGAGGCAGTGGCATT
ATTGAAAAGAACATCATCCTCGATAGTAC
TCAAAGCTTTGGAAGTCAAAGAGGGTAGC
ATCGTTTGA

Tags and additions: N-terminal, TEV cleavable hexahistidine tag.

Final protein sequence (His408 to Glu498):
mhhhhhhssgvdlgtenlyfqsMHEKVVN
IQKDPGESLGMTVAGGASHREWDLPIYVI
SVEPGGVISRDGRIKTGDILLNVDGVELT
EVSRSEAVALLKRTSSSIVLKALEVKEGS
IV

The N-terminal residues, mhhhhhhssgvdlgtenlyfqsM, derive from the vector.
The C-terminal residues, GSIV, are an addition to promote crystallisation.

Host:BL21(DE3)-R3-pRARE2 (previously known as Rosetta)

Transformation: The construct DNA was transformed into homemade chemically competent cells of the expression strain by a standard heat shock procedure.

Glycerol stock preparation: A number of colonies from the transformation were used to inoculate 1 ml of LB media containing 50 µg/ml kanamycin and 34 µg/ml chloramphenicol, which was placed in a 37°C shaker overnight. The next day glycerol stocks were prepared from this overnight culture.

Expression: A glycerol stock was used to inoculate 10 ml of LB media containing 50 µg/ml kanamycin and 34 µg/ml chloramphenicol, which was placed in a 37°C shaker overnight. The next day this starter culture was used to inoculate 1L of TB media containing 50 µg/ml kanamycin. When the OD₆₀₀ was approximately 1.0, the temperature was reduced to 25°C and the cells were induced by the addition of IPTG. The expression was continued overnight.

Cell harvest: Cells were spun at 5000rpm for 20 mins and the pellets frozen.

Purification: Cell Lysis: The cells were resuspended in an equal volume of 2x Lysis Buffer. The resuspended cell pellet was lysed by high-pressure homogenization. PEI (polyethyleneimine) was added to a final concentration of 0.15 % and the cell debris and precipitated DNA were spun down (17000 rpm, JA17 rotor, 30 min). Lysis Buffer: 50 mM Potassium Phosphate pH 8.0, 500 mM NaCl, 10% Glycerol, 0.5 mM TCEP, 1:1000 dilution of Novagen Protease Inhibitor Cocktail VII.

Column 1: HisTrap FF 5 ml (IMAC).

Column 1 Buffers: Binding Buffer: 50 mM Potassium Phosphate pH 8.0, 500 mM NaCl, 10% Glycerol, 0.5 mM TCEP; Wash Buffer: 50 mM Potassium Phosphate pH 8.0, 500 mM NaCl, 10% Glycerol, 0.5 mM TCEP, 30 mM Imidazole; Elution Buffer: 50 mM Potassium Phosphate pH 8.0, 500 mM NaCl, 10% Glycerol, 0.5 mM TCEP, 250 mM Imidazole.

Column 2: S75 16/60 Gel Filtration.

Column 2 Buffers: GF Buffer: 10 mM Hepes pH 7.4, 500 mM NaCl, 5% Glycerol, 0.5 mM DTT

Column 1 and 2 Procedure: The protein was purified through the two columns using an automated method on an AktaExpress system.

Concentration: The pooled fractions from Column 2 were concentrated to 64 mg/ml (measured by 280 nm absorbance), distributed into aliquots and frozen at -80°C.

Mass spectrometry characterisation: Measured: 12805; Expected: 12806.

Crystallisation: Crystals grew from a mixture of protein and precipitant solution (0.8 M Potassium Sodium Phosphate pH 6.0, 1% PEG 3350), using the vapour diffusion method.

Data Collection: Crystals were cryo-protected by equilibration into precipitant solution containing 20% Ethylene glycol, and then flash frozen in liquid nitrogen. Resolution: 1.75 Å; Data was collected at the Swiss Light Source, beamline X10.

References

Chen J, Xu J, Zhao W, Hu G, Cheng H, Kang Y, Xie Y, Lu Y.(2005). Characterization of human LNX, a novel ligand of Numb protein X that is downregulated in human gliomas. Int. J. Biochem. Cell. Biol. 37: 2273-2283.

Dho SE, Jacob S, Wolting CD, French MB, Rohrschneider LR, McGlade CJ. (1998). The mammalian numb phosphotyrosine-binding domain. Characterization of binding specificity and identification of a novel PDZ domain-containing numb binding protein, LNX. J. Biol. Chem. 273: 9179-9187.

Lim J, Hao T, Shaw C, Patel AJ, Szabo G, Rual JF, Fisk CJ, Li N, Smolyar A, Hill DE, Barabasi AL, Vidal M, Zoghbi HY. (2006). A protein-protein interaction network for human inherited ataxias and disorders of Purkinje cell degeneration. Cell. 125: 801-814.

Rice DS, Northcutt GM, Kurschner C. (2001). The Lnx family proteins function as molecular scaffolds for Numb family proteins. Mol. Cell. Neurosci. 18: 525-540.

Sollerbrant K, Raschperger E, Mirza M, Engstrom U, Philipson L, Ljungdahl PO, Pettersson RF. (2003). The Coxsackievirus and adenovirus receptor (CAR) forms a complex with the PDZ domain-containing protein ligand-of-numb protein-X (LNX). J. Biol. Chem. 278: 7439-7444.