Human acyl-Coenzyme A binding domain containing 5 in complex with stearoyl-CoA

Target ID:

ACBD5A

Aliases:

ACBD5DKFZp434A2417KIAA1996

Deposition Date:

Friday 19th December 2008

Families:

Miscellaneous

Structure type:

protein-ligand

Download Coordinates:

3FLV

Authors:

Ugochukwu, E.; Roos, A.; Yue, W. W.; Shafqat, N.; Savitsky, P.; Muniz, J. R. C.; von Delft, F.; Bountra, C.; Arrowsmith, C. H.; Weigelt, J.; Edwards, A.; Oppermann, U.

Site:

Oxford

ICM Datapack:

ICM Datapack

3FLV

tabs

Structure Details

Long-chain acyl-CoA thioesters have fundamental roles in cellular physiology. They serve as important intermediates in lipid biosynthesis and fatty acid degradation, and are signaling molecules in metabolism and gene regulation. Because they are poorly soluble, and bind unspecifically to cellular proteins, free intracellular fatty acids and fatty acyl-CoA derivatives are maintained at a low concentration under physiological condition (i.e. 0.1- 200 nM) by being sequestered with carrier proteins such as the acyl-CoA binding proteins.

Acyl-CoA binding proteins are intracellular cytosolic proteins of ~10-kDa, highly conserved in all eukaryotes and ubiquitously expressed. They bind saturated and unsaturated C14-C22 acyl-CoA thioesters via a conserved acyl-CoA binding domain (ACBD) in a non-covalent and reversible manner, with high specificity and affinity (KD1-5 nM). In cells, acyl-CoA in complex with acyl-CoA binding proteins are the preferred substrate for many acyl-CoA-utilizing enzymes. In humans, seven members of the ACBD-containing protein family have been identified (ACBD1-7), which shares a conserved ACBD at the N-terminus but vary in size and domains for the C-terminal region. We have determined the crystal structure of the functionally-uncharacterized ACBD5 protein in the family. ACBD5 is predicted to be membrane-bound with a transmembrane single-pass helix. Subcellular localization studies showed that rat liver ACBD5 is localized in peroxisomes. The ACBD5 gene is located at chromosome 10p12.1.

Materials and Methods

Entry Clone Source: MGC

Entry Clone Accession: IMAGE:5218685

SGC Construct ID: ACBD5A-c008

GenBank GI number: gi|109689720

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified DNA sequence:
CATATGCACCATCATCATCATCATTCTTC
TGGTGTAGATCTGGGTACCGAGAACCTGT
ACTTCCAATCCATGCACGAGACTAGGTTT
GAGGCGGCCGTGAAGGTGATCCAGAGTTT
GCCGAAGAATGGTTCATTCCAGCCAACAA
ATGAAATGATGCTTAAATTTTATAGCTTC
TATAAGCAGGCAACTGAAGGACCCTGTAA
ACTTTCAAGGCCTGGATTTTGGGATCCTA
TTGGAAGATATAAATGGGATGCTTGGAGT
TCACTGGGTGATATGACCAAAGAGGAAGC
CATGATTGCATATGTTGAAGAAATGAAAA
AGATTATTGAAACTATGCCAATGACTGAG
AAAGTTGAAGAATGACAGTAAAGGTGGAT
ACGGATCCGAA

Tags and additions: N-terminal Histidine-tag with TEV protease cleavage site

Protein construct sequence (tag residues in lowercase):
mhhhhhhssgvdlgtenlyfqs*MHETRF
EAAVKVIQSLPKNGSFQPTNEMMLKFYSF
YKQATEGPCKLSRPGFWDPIGRYKWDAWS
SLGDMTKEEAMIAYVEEMKKIIETMPMTE
KVEE

Host: BL21(DE3)-R3 pRARE2

Growth medium, induction protocol: 10ul of a glycerol stock was inoculated into 5ml of TB medium (supplemented with 50 µg/ml Kanamycin, 34 µg/ml Chloramphenicol) and cultured at 37°C overnight in a shaking incubator (275 rpm). Next day 0.75 ml of overnight culture was used to inoculate 1 litre of TB medium (6 x) and grown at 37°C with vigorous shaking (160 rpm) until the culture reaches an OD₆₀₀ of 1.5. Temperature was reduced to 18°C, and cells were induced with IPTG at a concentration of 0.5 mM, and further cultivated for 16 hrs. Cells were harvested by centrifugation at 6500 rpm for 10 min, and the cell pellet was stored at -20°C until further use.

Extraction buffer, extraction method: Lysis buffer: 500 mM NaCl, 5% Glycerol, 50 mM HEPES pH 7.5, 5 mM Imidazole, Complete® protease inhibitors (Roche, 1 tbl/50 ml). Frozen cell pellets were thawed and resuspended in a total volume of 30-40 ml of lysis buffer, and disrupted by using sonicator, and a supernatant containing the target protein was obtained by centrifugation at 21,000 (rpm) for 45 minutes.

Column 1: Ni-Sepharose 6 Fast Flow

Buffers: Lysis buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 5% Glycerol, 5 mM Imidazole; Wash buffer: 50 mM Tris-HCl pH 7.5, 500 mM NaCl, 5% Glycerol, 30 mM Imidazole; Elution buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 5% Glycerol, 250 mM Imidazole. Note: All the buffers contain 0.5mM TCEP.

Procedure: The column was packed with 2 ml of Ni-Sepharose 6 Fast Flow slurry and equilibrated with 15 ml of binding buffer. The supernatant was loaded onto the column and the column was washed with 20 ml of binding buffer and then 20 ml of washing buffer. The protein was eluted with 10 ml of elution buffer.

Column 2: SuperDex 75 16/60 HiLoad (GE/Amersham)

Buffer: 10 mM HEPES, pH 7.5, 500 mM NaCl, 5 % glycerol, 0.5 mM TCEP.

Procedure: The eluted protein from the Ni-affinity column was loaded on the gel filtration column in GF buffer at 1.0 ml/min on an AKTA Purifier system. Eluted proteins were collected in 1 ml fractions.

Enzymatic treatment: TEV cleaved.

Column 3: Ni-NTA (TEV clean-up)

Buffer: 10 mM HEPES, pH 7.5, 500 mM NaCl, 5% glycerol, 0.5 mM TCEP

Procedure: Total 5 mgs of protein was cleaved with 300 ug of TEV protease at 4 degree C for 48 hours.

TEV clean up: The TEV cleaved protein was applied to a 1 ml Ni-NTA column, already equalibrated with gel filtration buffer (10 mM HEPES, pH 7.5, 500 mM NaCl, 5% glycerol, 0.5 mM TCEP). The flow through form the column was collected. The eluate from the column was monitored by SDS gel analysis.

Concentration: The target protein was concentrated to 17.13 mg/ml using Vivaspin 5K concentrators and stored at -80°C.

Mass spec characterization: Corresponds to theoretical mass, as determined by ESI-TOF MS.

Crystallization: Crystals were grown by vapour diffusion in sitting drops at 4°C. Before setting up the experiment stearoyl-CoA was added to the protein to a final concentration of 3mM. A sitting drop consisting of 50 nl protein and 100 nl well solution was equilibrated against well solution containing 0.2M Mg(ac)₂; 0.1M cacodylate pH 6.5; 20% PEG 8K. Crystals were cryo protected in 30% glycerol and flash-cooled in liquid nitrogen.

Data Collection, Resolution: 1.9 Å, X-ray source: Synchrotron SLS-X10SA, single wavelength.