Human mitogen-activated protein kinase kinase 6 in complex with K00207

Target ID:

MAP2K6A

Aliases:

MAP2K6MAPKK6MEK6MKK6PRKMK6SAPKK3

Deposition Date:

Sunday 21st December 2008

Families:

Protein Kinase

Structure type:

protein-ligand

Download Coordinates:

3FME

Authors:

\\\

Site:

Oxford

3FME

tabs

Structure Details

MAP2K6 is involved in many cellular processes such as stress induced cell cycle arrest, transcription activation and apoptosis. Upon activation, MAP2K6 phosphorylates its downstream signaling partner p38 MAP kinase. MAP2K6 has been shown to regulate development of thymocytes and osteoclasts as well as to play a role during muscle differentiation [1,2]. This role has been confirmed in mice with a homozygous deletion of Map2k6 which grow normally but show defects in thymocyte development [3,4].

MAP2K6 has been shown to be targeted by a number of pathogens. For instance the Yersinia YopJ protein acetylates Ser-207 and Thr-211 in the activation loop of MAP2K6 preventing its phosphorylation and thus activation of the MAPK signaling pathway [5]. MAP2K6 is also targeted by the Anthrax lethal factor which proteolytically cleaves and inactivates MAP2K6 and other MAP2Ks [6].

MAP2K6 function has been linked to several diseases: Sequence variations of MAP2K6 leading to partially sex-specific changes may contribute to delaying effects in the age at onset of Huntington’s disease [7]. In addition, MAP2K6 provides cardioprotection upon ischemia as shown in a mouse model targeting MAP2K6 expression to the heart [8]. MAP2K6 expression in an in vivo tumor model leads to tumor suppression and reduced metastatic colonization in human ovarian carcinoma [9,10].

Here we present the structure of MAP2K6 catalytic domain activated double mutant (Ser207/Asp; Thr211Asp) in complex with staurosporine at 2.4 Å resolution.

Materials and Methods

Entry Clone Source: Site-directed mutagenesis

Entry Clone Accession: n/a

SGC Construct ID: MAP2K6A-c025

GenBank GI number: gi|14589900

Entry clone source: MGC, site directed mutagenesis

GI number: gi|14589900

Final protein sequence (tag sequence shown in lowercase):
mhhhhhhssgvdlgtenlyfq^SMEVKAD
DLEPIMELGRGAYGVVEKMRHVPSGQIMA
VKRIRATVNSQEQKRLLMDLDISMRTVDC
PFTVTFYGALFREGDVWICMELMDTSLDK
FYKQVIDKGQTIPEDILGKIAVSIVKALE
HLHSKLSVIHRDVKPSNVLINALGQVKMC
DFGISGYLVDDVAKDIDAGCKPYMAPERI
NPELNQKGYSVKSDIWSLGITMIELAILR
FPYDSWGTPFQQLKQVVEEPSPQLPADKF
SAEFVDFTSQCLKKNSKERPTYPELMQHP
FFTLHESKGTDVASFVKLILGD

^ TEV cleave site
The mutated residues (Ser207/Asp; Thr211Asp are highlighted in red)

Amplified construct sequence:
CATATGCACCATCATCATCATCATTCTTC
TGGTGTAGATCTGGGTACCGAGAACCTGT
ACTTCCAATCCATGGAGGTGAAGGCAGAT
GACCTGGAGCCTATAATGGAACTGGGACG
AGGTGCGTACGGGGTGGTGGAGAAGATGC
GGCACGTGCCCAGCGGGCAGATCATGGCA
GTGAAGCGGATCCGAGCCACAGTAAATAG
CCAGGAACAGAAACGGCTACTGATGGATT
TGGATATTTCCATGAGGACGGTGGACTGT
CCATTCACTGTCACCTTTTATGGCGCACT
GTTTCGGGAGGGTGATGTGTGGATCTGCA
TGGAGCTCATGGATACATCACTAGATAAA
TTCTACAAACAAGTTATTGATAAAGGCCA
GACAATTCCAGAGGACATCTTAGGGAAAA
TAGCAGTTTCTATTGTAAAAGCATTAGAA
CATTTACATAGTAAGCTGTCTGTCATTCA
CAGAGACGTCAAGCCTTCTAATGTACTCA
TCAATGCTCTCGGTCAAGTGAAGATGTGC
GATTTTGGAATCAGTGGCTACTTGGTGGA
CGATGTTGCTAAAGACATTGATGCAGGTT
GCAAACCATACATGGCCCCTGAAAGAATA
AACCCAGAGCTCAACCAGAAGGGATACAG
TGTGAAGTCTGACATTTGGAGTCTGGGCA
TCACGATGATTGAGTTGGCCATCCTTCGA
TTTCCCTATGATTCATGGGGAACTCCATT
TCAGCAGCTCAAACAGGTGGTAGAGGAGC
CATCGCCACAACTCCCAGCAGACAAGTTC
TCTGCAGAGTTTGTTGACTTTACCTCACA
GTGCTTAAAGAAGAATTCCAAAGAACGGC
CTACATACCCAGAGCTAATGCAACATCCA
TTTTTCACCCTACATGAATCCAAAGGAAC
AGATGTGGCATCTTTTGTAAAACTGATTC
TTGGAGACTGACAGTAAAGGTGGATACGG
ATCCGAA

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Tags and additions: Cleavable N-terminal His6 tag.

Host: BL21 (DE3)R3 (Phage resistant strain)

Growth medium, induction protocol: 1ml from a 10 ml overnight culture containing 50 µg/ml kanamycin was used to inoculate 1 litre of LB containing 50 µg/ml kanamycin. Cultures were grown at 37°C until the OD₆₀₀ reached ~0.3 then the temperature was adjusted to 18°C. Expression was induced for overnight using 1 mM IPTG at anOD₆₀₀ of 0.8. The cells were collected by centrifugation and the pellet resuspended in binding buffer and frozen. Binding buffer: 50mM HEPES pH 7.5; 500 mM NaCl; 5 mM imidazole, 5% glycerol; 0.5 mM TCEP.

Extraction buffer, extraction method: Frozen pellets were thawed and cells lysed using a high pressure cell disrupter. The lysate was centrifuged at 17,000 rpm for 30 minutes and the supernatant collected for purification.

Column 1: Ion exchange - Nucleic acid removal. DEAE cellulose (DE52, Whatman), 10 g of resin in 2.5 x 20 cm column. The resin was hydrated in 2.5M NaCl, then washed with 20 ml binding buffer prior to loading the sample.

Buffers: 50mM HEPES pH 7.5; 500 mM NaCl; 5 mM imidazole, 5% glycerol; 0.5 mM TCEP

Procedure: Supernatant was applied by gravity flow, followed by a wash with 100 ml binding buffer. The column flow-through was collected.

Column 2: Ni-affinity. Ni-NTA (Qiagen), 5 ml of 50% slurry in 1.5 x 10 cm column, washed with binding buffer.

Buffers: Binding buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 5% Glycerol, 0.5 mM TCEP
Wash buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 30 mM Imidazole, 5% glycerol, 0.5 mM TCEP
Elution buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 50 to 250 mM Imidazole , 5% Glycerol, 0.5 mM TCEP

Procedure: The flowthrough from column 1 was loaded by gravity flow on the Ni-NTA column. The column was then washed with 100 ml wash buffer at gravity flow. The protein was eluted by gravity flow by applying 5-ml portions of elution buffer with increasing concentration of imidazole (50 mM, 100 mM, 150 and 250 mM); fractions were collected until essentially all protein was eluted.

Enzymatic treatment : The N-terminal His tag was cleaved by treatment with TEV protease

Column 3: Size Exclusion Chromatography. Superdex S200 16/60 HiLoad

Buffers: 25 mM HEPES, pH 7.5; 250 mM NaCl, 5 mM DTT

Procedure: MAP2K6 was concentrated and applied to an S200 16/60 HiLoad gel filtration column equilibrated in 25 mM HEPES, pH 7.5; 250 mM NaCl, 5 mM DTT using either an ÄKTAprime or ÄKTAexpress system.

Mass spectrometry characterization: LC- ESI -MS TOF gave a measured mass of 32710 for this construct as predicted from the sequence of this protein.

Protein concentration: Protein was concentrated to 9.8 mg/ml using an Amicon 3 kDa cut-off concentrator.

Crystallization: Initial crystals grown in 30% PEG-3350, 0.2M MgCl2, Tris-HCl pH 7.5 were used for seeding. Diffraction quality crystals were grown at 4°C in 150 nl drops from a 1:1 ratio of protein and reservoir solution (0.05 M Mg formate pH5.9; 10 w/v PEG3350).

Data Collection: Crystals were cryo-protected using 20% glycerol.
X-ray source: Diffraction data were collected at the SLS beamline X10 at a single wavelength of 1.000 Å.
Resolution: 2.3 Å resolution limit.

References

1. Yamashita, T., Kobayashi, Y., Mizoguchi, T., Yamaki, M., Miura, T., Tanaka, S., Udagawa, N., and Takahashi, N. (2008). MKK6-p38 MAPK signaling pathway enhances survival but not bone-resorbing activity of osteoclasts. Biochemical and biophysical research communications 365, 252-257.

2. Serra, C., Palacios, D., Mozzetta, C., Forcales, S.V., Morantte, I., Ripani, M., Jones, D.R., Du, K., Jhala, U.S., Simone, C., et al. (2007). Functional interdependence at the chromatin level between the MKK6/p38 and IGF1/PI3K/AKT pathways during muscle differentiation. Molecular cell 28, 200-213.

3. Tanaka, N., Kamanaka, M., Enslen, H., Dong, C., Wysk, M., Davis, R.J., and Flavell, R.A. (2002). Differential involvement of p38 mitogen-activated protein kinase kinases MKK3 and MKK6 in T-cell apoptosis. EMBO reports 3, 785-791.

4. Suzuki, H., Wu, J., Hossain, K., Ohhata, T., Du, J., Akhand, A.A., Hayakawa, A., Kimura, H., Hagiwara, M., and Nakashima, I. (2003). Involvement of MKK6 in TCRalphabeta(int)CD69lo: a target population for apoptotic cell death in thymocytes. Faseb J 17, 1538-1540.

5. Mukherjee, S., Keitany, G., Li, Y., Wang, Y., Ball, H.L., Goldsmith, E.J., and Orth, K. (2006). Yersinia YopJ acetylates and inhibits kinase activation by blocking phosphorylation. Science (New York, NY 312, 1211-1214.

6. Bardwell, A.J., Abdollahi, M., and Bardwell, L. (2004). Anthrax lethal factor-cleavage products of MAPK (mitogen-activated protein kinase) kinases exhibit reduced binding to their cognate MAPKs. The Biochemical journal 378, 569-577.

7. Arning, L., Monte, D., Hansen, W., Wieczorek, S., Jagiello, P., Akkad, D.A., Andrich, J., Kraus, P.H., Saft, C., and Epplen, J.T. (2008). ASK1 and MAP2K6 as modifiers of age at onset in Huntington's disease. Journal of molecular medicine (Berlin, Germany) 86, 485-490.

8. Martindale, J.J., Wall, J.A., Martinez-Longoria, D.M., Aryal, P., Rockman, H.A., Guo, Y., Bolli, R., and Glembotski, C.C. (2005). Overexpression of mitogen-activated protein kinase kinase 6 in the heart improves functional recovery from ischemia in vitro and protects against myocardial infarction in vivo. The Journal of biological chemistry 280, 669-676.

9. Timofeev, O., Lee, T.Y., and Bulavin, D.V. (2005). A subtle change in p38 MAPK activity is sufficient to suppress in vivo tumorigenesis. Cell cycle (Georgetown, Tex 4, 118-120.

10. Hickson, J.A., Huo, D., Vander Griend, D.J., Lin, A., Rinker-Schaeffer, C.W., and Yamada, S.D. (2006). The p38 kinases MKK4 and MKK6 suppress metastatic colonization in human ovarian carcinoma. Cancer research 66, 2264-2270.