Human bone morphogenetic protein receptor, type II (serine/threonine kinase) [isoform 1 precursor]

Target ID:

BMPR2A

Aliases:

BMPR-IIBMPR2BMPR3BMR2BRK-3FLJ41585FLJ76945PPH1T-ALK

Deposition Date:

Saturday 31st January 2009

Families:

Protein Kinase

Related Diseases:

Cancer

Structure type:

protein-ligand

Download Coordinates:

3G2F

Authors:

Chaikuad, A. Thangaratnarajah, C. Roos, A. Filippakopoulos, P. Salah, E. Phillips, C. Keates, T. Fedorov, O. Chalk, R. Petrie, K. Pike, A. Von Delft, F. Arrowsmith, C.H. Edwards, A.M. Weigelt, J. Bountra, C. Knapp, S. Bullock, A.

Site:

Oxford

3G2F

tabs

Structure Details

BMPR2 belongs to the bone morphogenetic protein (BMP) receptor family of transmembrane serine/threonine kinases. Secreted BMPs, which are members of the TGF-beta superfamily involved in endochondral bone formation and embryogenesis, induce heteromeric assembly of type I and type II receptors. Seven members of the type I and five members of the type II receptor are identified in mammals [1]. The type II receptor functions to activate the type I receptor by phosphorylation of its glycine-serine rich (GS) domain. Subsequently, the type I receptor binds and phosphorylates members of the Smad family of transcription factors. The type II receptor BMPR2 associates principally with BMPR1A, BMPR1B and ACVR1 which all target SMAD1/5/8. However, BMPR2 can signal through many additional pathways of which the best characterised downstream signaling molecules are p38, pERK, JNK, and Akt/PI3K [2]. In particular, BMPR2 is unique among the five type II receptors in having a long C-terminal tail domain shown to be important for the regulation of cytoskeletal protein function [3,4].

Mutations in BMPR2 are a cause of pulmonary arterial hypertension, a rare autosomal dominant disorder characterized by plexiform lesions of proliferating endothelial cells in pulmonary arterioles. Eventually these lesions lead to elevated pulmonary arterial pression, right ventricular failure, and death [5]. Mutations in BMPR2 cause a loss of function or dominant negative effect and can be found in the extracellular ligand-binding domain, in the kinase domain, or in the long cytoplasmic tail, all of which can affect the signaling mechanism as well as interaction of the receptor with the cytoskeleton [2]. The disease phenotype can be mimicked in heterozygous mutant mice which develop increased arterial pressure and pulmonary vascular resistance compared with their wild-type littermates [6]. However, homozygous knockout mice die at the gastrulation stage of embryogenesis consistent with a critical role for BMPR2 in development [7].

Loss of BMPR2 is also associated with some cancer types and is linked to a 5-year survival rate in human prostate cancer [8]. Overexpression of a dominant negative form of BMPR2 has been shown to inhibit growth of human breast cancer cells [9]. Finally, in mice conditional inactivation of BMPR2 in the stroma leads to epithelial hyperplasia throughout the colon with increased epithelial cell proliferation and polyp formation [10].

Here we present the structure of the kinase domain of BMPR2 refined at 2.35 Å resolution in complex with ADP and Mg2+.

Materials and Methods

Entry Clone Source: Origene

Entry Clone Accession: NM_001204 variant

SGC Construct ID: BMPR2A-c019

GenBank GI number: gi|15451916

Vector: pNIC-CH. Details [ PDF ]; Sequence [ FASTA ] or [ GenBank ]

Construct DNA sequence:
CTTAAGAAGGAGATATACTATGGAGGCAG
CAGCATCCGAACCCTCTCTTGATCTAGAT
AATCTGAAACTGTTGGAGCTGATTGGCCG
AGGTCGATATGGAGCAGTATATAAAGGCT
CCTTGGATGAGCGTCCAGTTGCTGTAAAA
GTGTTTTCCTTTGCAAACCGTCAGAATTT
TATCAACGAAAAGAACATTTACAGAGTGC
CTTTGATGGAACATGACAACATTGCCCGC
TTTATAGTTGGAGATGAGAGAGTCACTGC
AGATGGACGCATGGAATATTTGCTTGTGA
TGGAGTACTATCCCAATGGATCTTTATGC
AAGTATTTAAGTCTCCACACAAGTGACTG
GGTAAGCTCTTGCCGTCTTGCTCATTCTG
TTACTAGAGGACTGGCTTATCTTCACACA
GAATTACCACGAGGAGATCATTATAAACC
TGCAATTTCCCATCGAGATTTAAACAGCA
GAAATGTCCTAGTGAAAAATGATGGAACC
TGTGTTATTAGTGACTTTGGACTGTCCAT
GAGGCTGACTGGAAATAGACTGGTGCGCC
CAGGGGAGGAAGATAATGCAGCCATAAGC
GAGGTTGGCACTATCAGATATATGGCACC
AGAAGTGCTAGAAGGAGCTGTGAACTTGA
GGGACTGTGAATCAGCTTTGAAACAAGTA
GACATGTATGCTCTTGGACTAATCTATTG
GGAGATATTTATGAGATGTACAGACCTCT
TCCCAGGGGAATCCGTACCAGAGTACCAG
ATGGCTTTTCAGACAGAGGTTGGAAACCA
TCCCACTTTTGAGGATATGCAGGTTCTCG
TGTCTAGGGAAAAACAGAGACCCAAGTTC
CCAGAAGCCTGGAAAGAAAATAGCCTGGC
AGTGAGGTCACTCAAGGAGACAATCGAAG
ACTGTTGGGACCAGGATGCAGAGGCTCGG
CTTACTGCACAGTGTGCTGAGGAAAGGAT
GGCTGAACTTATGATGATTTGGGAAAGAA
ACAAATCTGTGAGCCCAACAGCGCACCAT
CATCACCACCATTGAGGATCC

Tags and additions: ahhhhhh. Non-cleavable C-terminal hexahistidine tag.

Expressed protein sequence (tag sequence in lowercase):
MEAAASEPSLDLDNLKLLELIGRGRYGAV
YKGSLDERPVAVKVFSFANRQNFINEKNI
YRVPLMEHDNIARFIVGDERVTADGRMEY
LLVMEYYPNGSLCKYLSLHTSDWVSSCRL
AHSVTRGLAYLHTELPRGDHYKPAISHRD
LNSRNVLVKNDGTCVISDFGLSMRLTGNR
LVRPGEEDNAAISEVGTIRYMAPEVLEGA
VNLRDCESALKQVDMYALGLIYWEIFMRC
TDLFPGESVPEYQMAFQTEVGNHPTFEDM
QVLVSREKQRPKFPEAWKENSLAVRSLKE
TIEDCWDQDAEARLTAQCAEERMAELMMI
WERNKSVSPTahhhhhh

Host: BL21 (DE3)R3-pRARE2 (Phage resistant strain)

Growth medium, induction protocol: A glycerol stock was used to inoculate a 50 ml starter culture containing TB media and 34 µg/ml chloramphenicol and 50 µg/ml kanamycin. The starter culture was grown overnight at 37°C with shaking at 250 rpm. The following morning six flasks containing 500 ml TB media with 34 µg/ml chloramphenicol and 50 µg/ml kanamycin were each inoculated with 5 ml of the starter culture. Cultures were incubated at 37°C with shaking at 180 rpm until an OD₆₀₀ ≥ 0.5 was reached. The flasks were then cooled down to 18°C and 0.5 mM IPTG added to induce protein expression overnight. Cells were harvested by centrifugation at 4500 rpm at 4°C for 15 min. Cell pellets from each flask were resuspended in 30 ml binding buffer (50 mM Hepes, pH 7.5; 500 mM NaCl; 5% Glycerol; 5 mM imidazole), transferred to 50 ml tubes, and stored at -20°C.

Extraction buffer, extraction method: The frozen cells were thawed and 0.5 mM TCEP, 1 mM PMSF, and 10 mM L-arginine/10 mM L-glutamate mix were added to the cell suspension. The cells were lysed by sonication over 12 min with the sonicator pulsing ON for 5 sec and OFF for 15 sec. The cell lysate was spun down by centrifugation at 16.5k rpm and 4°C for 1 h. The supernatant was recovered for purification.

Column 1: Anion-exchange for Nucleic acid removal with DEAE cellulose (DE52, Whatmann). 10 g of resin was suspended in 100 ml 2.5 M NaCl, and then applied onto a 2.5 x 20 cm column. The resin was then equilibrated with 100 ml binding buffer prior to loading the sample.

Buffers: Binding buffer: 50 mM Hepes, pH 7.5; 500 mM NaCl; 5% Glycerol; 5 mM imidazole; Wash buffer: 50 mM Hepes, pH 7.5; 500 mM NaCl; 5% Glycerol; 30 mM imidazole.

Procedure: The supernatant was first applied onto the column by gravity flow, which was followed by a wash with 100 ml wash buffer. The column flow-through and wash was directly applied onto a Ni-IDA column.

Column 2: Ni-Affinity Chromatography. 5 ml of 50 % Ni-IDA slurry (Genscript) was applied onto a 1.5 x 10 cm column. The column was first washed deionised destilled H2O, and then equilibrated with binding buffer.

Buffers: Binding buffer: 50 mM Hepes, pH 7.5; 500 mM NaCl; 5% Glycerol; 5 mM imidazole; Wash buffer: 50 mM Hepes, pH 7.5; 500 mM NaCl; 5% Glycerol; 30 mM imidazole; Elution buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% Glycerol; 50 to 250 mM imidazole.

Procedure: The flow-through from column 1 (DE52) was applied by gravity flow onto the Ni-IDA column. The bound protein was eluted by applying a step gradient of imidazole – using 7 ml portions of elution buffer with increasing concentration of imidazole (50 mM, 100 mM, 150 mM, 250 mM). 10 mM DTT was added to each fraction collected for overnight storage at 4°C.

Enzymatic treatment: No treatment was required as the protein was expressed with a non-cleavable C-terminal His6 tag.

Column 3: Size Exclusion Chromatography – S200 HiLoad 16/60 Superdex run on ÄKTA-Express

Buffer: Gel Filtration buffer: 300 mM NaCl, 25 mM Hepes pH 7.5, 1mM DTT

Procedure: Prior to applying the protein, the S200 16/60 column was washed and equilibrated with gel filtration buffer. Eluted protein from the Ni-IDA column was pooled and concentrated to 3 ml using an Amicon Ultra-15 filter with a 10 kDa cut-off. The concentrated protein was directly applied onto the equilibrated S200 16/60 column, and run at a flow-rate of 1 ml/min. The protein was eluted at 80 – 95 ml. Fractions containing the protein were pooled together, and 10 mM DTT was added for overnight storage at 4°C.

Column 4: Anion-exchange - MonoQ 5/50 GL column on ÄKTA-Purifier

Buffers: Buffer A (low salt): 50 mM Hepes pH 7.4; Buffer B (high salt): 50 mM Hepes, pH 7.4; 1 M NaCl.

Procedure: Prior to applying the protein, the MonoQ column was washed with buffer B before equilibration with buffer A. The eluted protein from gel filtration was diluted with buffer A to 50 ml then applied to a MonoQ column, and run at a flow-rate of 1 ml/min with a linear gradient. The protein was eluted at 13-14% buffer B. Fractions containing the protein were pooled and the buffer adjusted to 50 mM Hepes pH 7.4, 300 mM NaCl, 10% glycerol, 10 mM DTT, 50 mM L-arginine/50 mM L-glutamate. Protein was stored at 4°C.

Concentration: The protein was concentrated in an Amicon Ultra-4 filter with a 10 kDa cut-off.

Mass spectrometry characterization: The purified protein was homogeneous and had an experimental mass of 38.413 kDa, as expected from its primary structure. Masses were determined by LC-MS, using an Agilent LC/MSD TOF system with reversed-phase HPLC coupled to electrospray ionisation and an orthogonal time-of-flight mass analyser. Proteins were desalted prior to mass spectrometry by rapid elution off a C3 column with a gradient of 5-95% acetonitrile in water with 0.1% formic acid.

Crystallization: Protein was buffered in 50 mM HEPES, pH 7.4, 300 mM NaCl, 10% glycerol, 10 mM DTT, 50 mM L-arginine/50 mM L-glutamate. To this 10 mM ADP was added and the protein concentrated to 5.8 mg/ml (calculated using an extinction co-efficient of 46870). Crystals were grown at 4°C in 150 nl sitting drops mixing 75 nl protein solution with 75 nl of a reservoir solution containing 25% PEG8000, 0.3 M (NH₄)₂SO₄, 0.1M Na-cacodylate pH 6.0, 50 mM MgCl₂. On mounting crystals were cryo-protected with an additional 20% ethylene glycol.

Data Collection: Resolution: 2.35Å, X-ray source: Swiss Light Source PX10

References

1. Sebald, W., Nickel, J., Zhang, J.L., and Mueller, T.D. (2004). Molecular recognition in bone morphogenetic protein (BMP)/receptor interaction. Biological chemistry 385, 697-710.

2. Rabinovitch, M. (2008). Molecular pathogenesis of pulmonary arterial hypertension. The Journal of clinical investigation 118, 2372-2379.

3. Hassel, S., Eichner, A., Yakymovych, M., Hellman, U., Knaus, P., Souchelnytskyi, S. (2004). Proteins associated with type II bone morphogenetic protein receptor (BMPR-II) and identified by two-dimensional gel electrophoresis and mass spectrometry. Proteomics 4, 1346-58.

4. Wong, W.K., Knowles, J.A., and Morse, J.H. (2005). Bone morphogenetic protein receptor type II C-terminus interacts with c-Src: implication for a role in pulmonary arterial hypertension. American journal of respiratory cell and molecular biology 33, 438-446.

5. Newman, J.H., Phillips, J.A., 3rd, and Loyd, J.E. (2008). Narrative review: the enigma of pulmonary arterial hypertension: new insights from genetic studies. Annals of internal medicine 148, 278-283.

6. Beppu, H., Ichinose, F., Kawai, N., Jones, R.C., Yu, P.B., Zapol, W.M., Miyazono, K., Li, E., and Bloch, K.D. (2004). BMPR-II heterozygous mice have mild pulmonary hypertension and an impaired pulmonary vascular remodeling response to prolonged hypoxia. American journal of physiology 287, L1241-1247.

7. Beppu, H., Kawabata, M., Hamamoto, T., Chytil, A., Minowa, O., Noda, T., and Miyazono, K. (2000). BMP type II receptor is required for gastrulation and early development of mouse embryos. Developmental biology 221, 249-258.

8. Kim, I.Y., Lee, D.H., Lee, D.K., Ahn, H.J., Kim, M.M., Kim, S.J., and Morton, R.A. (2004). Loss of expression of bone morphogenetic protein receptor type II in human prostate cancer cells. Oncogene 23, 7651-7659.

9. Pouliot, F., Blais, A., and Labrie, C. (2003). Overexpression of a dominant negative type II bone morphogenetic protein receptor inhibits the growth of human breast cancer cells. Cancer research 63, 277-281.

10. Beppu, H., Mwizerwa, O.N., Beppu, Y., Dattwyler, M.P., Lauwers, G.Y., Bloch, K.D., and Goldstein, A.M. (2008). Stromal inactivation of BMPRII leads to colorectal epithelial overgrowth and polyp formation. Oncogene 27, 1063-1070.