Human MST4 (Mst3 and SOK1-related kinase)

Target ID:

MST4A

Deposition Date:

Saturday 28th February 2009

Families:

Protein Kinase

Related Diseases:

Cancer

Structure type:

protein-ligand

Download Coordinates:

3GGF

Authors:

Chaikuad, A., Rellos, P., Eidarus, S., Das, S., Pike, A.C.W., Ritika, S., Roos, A.K., Filippakopoulos, P., Arrowsmith, C.H., Edwards, A.M., Weigelt, J., Bountra, C., Von Delft, F., Knapp, S.

Site:

Oxford

ICM Datapack:

ICM Datapack

3GGF

tabs

Structure Details

MST4 is a member of the GCK group III family of kinases, which are a subgroup of the serine/threonine kinase, sterile-20 (Ste20) kinases. MST4 is most closely related to mammalian MST3 and shares almost 90% amino acid identity in the kinase domain but less than 20% identity in the C-terminus [1] with this kinase. Since MST3 and MST4 have opposite effects on cell growth the C-terminal non-kinase regulatory domain may be essential in determining kinase function. The C-terminus of MST4 is necessary for ERK activation and promotion of cellular transformation and enhances MST4 kinase activity [2]. The C-terminus may also mediate homophilic interactions [3].

An alternatively spliced variant, MST4a, has been cloned from a fetal brain cDNA library. MST4a lacks part of the kinase domain, and probably acts as a dominant negative MST4 (Qian et al., 2001). MST4 is ubiquitously expressed with high levels in placenta, thymus, and peripheral blood leukocytes [2,4]. High levels of expression have been found in several cancer tissues and expression is directly correlated with tumorigenicity of human prostate cancer cell lines [4]. Overexpression of MST4 induces anchorage-independent growth and increases in vitro proliferation as well as in vivo tumorigenesis in prostate cancer cell lines [5] suggesting a role in prostate cancer progression. Dan et al have described pro-apoptotic activity of MST4 but further details remain to be established [3].

MST4 may also be involved in regulation of cell migration via its interaction with the Golgi protein GM130. Binding to GM130 activates MST4 as well as YSK, a related kinase, by promoting autophosphorylation of a conserved threonine within the T-loop. Interference with the kinase function perturbs perinuclear Golgi organization, cell migration, and invasion into type I collagen.

Here we present the structure of the unphosphorylated kinase domain of MAST4 refined at 2.35 Å resolution in complex with an ATP mimetic quinazolin inhibitor.

{4-[4-(-5-cyclopropyl-1H-Pyrazol-3ylamino)-quinazolin-2-ylamino]-phenyl}-acetonitrile.

The SGC would like to thank Prof. Kevan Shokat (Department of Cellular and Molecular Pharmacology, University of California San Francisco) for providing this inhibitor.

Materials and Methods

Entry Clone Source: Origene

Entry Clone Accession: NM_016542

SGC Construct ID: MST4A-c202

GenBank GI number: gi|15011880

Vector: "pLIC-SGC1". Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified DNA sequence:
TACTTCCAATCCATGGCCCACTCGCCGGT
GGCTGTCCAAGTGCCTGGGATGCAGAATA
ACATAGCTGATCCAGAAGAACTGTTCACA
AAATTAGAGCGCATTGGGAAAGGCTCATT
TGGGGAAGTTTTCAAAGGAATTGATAACC
GTACCCAGCAAGTCGTTGCTATTAAAATC
ATAGACCTTGAGGAAGCCGAAGATGAAAT
AGAAGACATTCAGCAAGAAATAACTGTCT
TGAGTCAATGTGACAGCTCATATGTAACA
AAATACTATGGGTCATATTTAAAGGGGTC
TAAATTATGGATAATAATGGAATACCTGG
GCGGTGGTTCAGCACTGGATCTTCTTCGA
GCTGGTCCATTTGATGAGTTCCAGATTGC
TACCATGCTAAAGGAAATTTTAAAAGGTC
TGGACTATCTGCATTCAGAAAAGAAAATT
CACCGAGACATAAAAGCTGCCAATGTCTT
GCTCTCAGAACAAGGAGATGTTAAACTTG
CTGATTTTGGAGTTGCTGGTCAGCTGACA
GATACACAGATTAAAAGAAATACCTTTGT
GGGAACTCCATTTTGGATGGCTCCTGAAG
TTATTCAACAGTCAGCTTATGACTCAAAA
GCTGACATTTGGTCATTGGGAATTACTGC
TATTGAACTAGCCAAGGGAGAGCCACCTA
ACTCCGATATGCATCCAATGAGAGTTCTG
TTTCTTATTCCCAAAAACAATCCTCCAAC
TCTTGTTGGAGACTTTACTAAGTCTTTTA
AGGAGTTTATTGATGCTTGCCTGAACAAA
GATCCATCATTTCGTCCTACAGCAAAAGA
ACTTCTGAAACACAAATTCATTGTAAAAA
ATTCAAAGAAGACTTCTTATCTGACTGAA
CTGATAGATCGTTTTAAGAGATGGAAGGC
AGAAGGACACAGTTGACAGTAAAGGTGGA
TA

Tags and additions: Tag sequence: *Cleavable N-terminal His 6 tag.

Final protein sequence (tag sequence in lowercase):
mhhhhhhssgvdlgtenlyfq^sMAHSPV
AVQVPGMQNNIADPEELFTKLERIGKGSF
GEVFKGIDNRTQQVVAIKIIDLEEAEDEI
EDIQQEITVLSQCDSSYVTKYYGSYLKGS
KLWIIMEYLGGGSALDLLRAGPFDEFQIA
TMLKEILKGLDYLHSEKKIHRDIKAANVL
LSEQGDVKLADFGVAGQLTDTQIKRNTFV
GTPFWMAPEVIQQSAYDSKADIWSLGITA
IELAKGEPPNSDMHPMRVLFLIPKNNPPT
LVGDFTKSFKEFIDACLNKDPSFRPTAKE
LLKHKFIVKNSKKTSYLTELIDRFKRWKA
EGHS

^ TEV cleavage site

Host: BL21(DE3)-R3-pRARE2

Expression protocol: Transformed 50 µl competent BL-21 (DE3) phage resistant cells with 10 µl of the plasmid DNA and plated out onto LB plate plus 100 µg/ml ampicilin. The next day colonies were picked out into fresh deep well blocks containing 1 ml TB + 50 µg/ml ampicilin which were grown overnight and glycerol stocks were prepared by adding 333 ml of 60 % glycerol to 1 ml of cell suspension, which were stored at -80°C to be used for future scale up preparations.
Cells were grown at 37°C until the OD₆₀₀ reached ~0.5. After that the temperature was lowered to 18°C. Protein production was induced with 1mM IPTG and recombinant MST4 was expressed at that temperature over night. The next day cells were harvested by centrifugation at 4000 rpm for 20 minutes. The cell pellet was stored at -20°C degrees.

Lysis and Ni-affinity chromatography: Buffers: Binding buffer: 50 mM HEPES pH 7.5, 300mM NaCl, 20 mM Imidazole; Wash buffer 1: 50 mM HEPES pH 7.5, 1M NaCl, 20mM Imidazole; Wash buffer 2:as for lysis buffer; Elution buffer: 50mM HEPES pH 7.5, 300mM NaCl, 200 mM Imidazole.

Procedure: The cell pellet (about 5g) was re-suspended in one volume (about 30 ml) of binding buffer. The re-suspended cells were lysed by sonication. The lysate was cleared of DNA and cell debris by centrifugation at 20,000 rpm (4°C).
5 ml of 50% Ni-NTA slurry (Qiagen) was applied to a 1.5 x 10 cm gravity column. The column was equilibrated with 100 ml binding buffer. The lysate was applied to the column and was subsequently washed with 50 ml wash buffer 1 and 2. MST4 was eluted with 25 mls of elution buffer. The eluted protein was collected and analyzed by SDS-PAGE. DTT was added to the protein sample to a final concentration of 5 mM. The N-terminal his6-tag was removed by the addition of approximately 100 mg of TEV protease and incubated at 4°C overnight. Kinase phosphorylation was removed by l-phosphatase in the presence of 50 mM MnCl₂.

Column 2: Size exclusion chromatography HiLoad 16/60 Superdex 200

SEC-Buffers: 50 mM Hepes, pH 7.5, 300 mM NaCl, 5 mM DTT.

Procedure: The Tev cleaved eluted protein was concentrated by ultrafiltration (using a 10kDa cutoff ultrafiltration unit) The sample was then loaded and fractionated at 0.8 ml/min, on a HiLoad 16/60 Superdex 200 column prequilibrated with SEC Buffer. Eluted fractions were 95% pure as judged by SDS-PAGE. The eluted fractions were concentrated to 11.2 mg/ml using ultarfiltration (as above).

Mass spec characterization: ESI-MS revealed that the protein had the expected mass 33818 Da.

Protein concentration: 11.2 mg/ml in SEC buffer using a centricon with a 10kDa cut off.

Crystallization: MST4 was crystallized at 4°C using the sitting-drop vapor diffusion method. Diffraction quality crystals were obtained by mixing 200 nl of protein solution (5.9 mg/ml) with 100 nl of reservoir solution comprising 10-16% w/v PEG3350; 0.005M CdCl₂ and 0.1M HEPES pH 7.0. Crystal growth was encouraged by the addition of 20nl of a concentrated seed stock to the unequilibrated drops.

Data Collection: Crystals were flash frozen in liquid nitrogen using the buffer used for crystallization supplemented with 20% PEG400. Diffraction data were collected to 2.35 Å on beamline X10SA at the Swiss light source.

References

1. Ling, P., Lu, T.J., Yuan, C.J., and Lai, M.D. (2008). Biosignaling of mammalian Ste20-related kinases. Cellular signalling 20, 1237-1247.

2. Qian, Z., Lin, C., Espinosa, R., LeBeau, M., and Rosner, M.R. (2001). Cloning and characterization of MST4, a novel Ste20-like kinase. The Journal of biological chemistry 276, 22439-22445.

3. Dan, I., Ong, S.E., Watanabe, N.M., Blagoev, B., Nielsen, M.M., Kajikawa, E., Kristiansen, T.Z., Mann, M., and Pandey, A. (2002). Cloning of MASK, a novel member of the mammalian germinal center kinase III subfamily, with apoptosis-inducing properties. The Journal of biological chemistry 277, 5929-5939.

4. Lin, J.L., Chen, H.C., Fang, H.I., Robinson, D., Kung, H.J., and Shih, H.M. (2001). MST4, a new Ste20-related kinase that mediates cell growth and transformation via modulating ERK pathway. Oncogene 20, 6559-6569.

5. Sung, V., Luo, W., Qian, D., Lee, I., Jallal, B., and Gishizky, M. (2003). The Ste20 kinase MST4 plays a role in prostate cancer progression. Cancer research 63, 3356-3363.