Human v-abl Abelson murine leukemia viral oncogene homolog 2 in complex with imatinib (Gleevec)

Target ID:

ABL2A

Aliases:

ABL2ABLLARGFLJ22224FLJ31718FLJ41441

Deposition Date:

Tuesday 31st March 2009

Families:

Protein Kinase

Structure type:

protein-ligand

Download Coordinates:

3GVU

Authors:

Ugochukwu, E. Salah, E. Barr, A. Mahajan, P. Shrestha, B. Savitsky, P. Chaikuad, A, Filippakopoulos, P. Roos, A. Pike, A.C.W. von Delft, F. Bountra, C. Arrowsmith, C.H. Weigelt, J. Edwards, A. Knapp, S.

Site:

Oxford

ICM Datapack:

ICM Datapack

3GVU

tabs

Structure Details

Abl2 (also known as ARG (ABL Related Gene)) is a member of the Abelson family of non-receptor tyrosine kinase. ABL2 shares a high degree of sequence conservation with cABL and has similar domain organization comprising an N-terminal SH3–SH2 kinase domain unit followed by a C-terminal domain containing docking sites for SH3 domains, F-actin and microtubules. Through its interactions with the cytoskeleton ABL2 plays a role in murine neurulation and it is required for adhesion-dependent neurite branching and synapse/dendrite stability. ABL2 has also a role in fibroblastic- and epithelial cell adhesion and migration. ABL2 shares a number of cellular regulatory functions with cABL. Targeted disruption of the cAbl gene in mice resulted in pleiotropic phenotypes including runtedness, high perinatal lethality, susceptibility to infections, and immune deficiencies. In contrast, homozygous Abl2 knockout mice are healthy and exhibit no immune-deficient phenotypes. However, evidence for overlapping roles of cAbl and Abl2 was obtained by analyzing mice deficient for both genes, which revealed that both proteins are required for normal mouse development. Abl/Abl2-/- mice die around embryonic day 10.5, and the embryos display bleeding in the pericardial sac, exhibit reduced proliferation and cytokine production in response to TCR stimulation and showed a significantly impaired antibody production.

Like ABL1, ABL2 is involved in human neoplastic diseases. Abl is up- or down-regulated in several solid tumors and oncogenic gene translocations involving the ETV6 gene have been described in human acute leukemia. Here we describe the structure of the kinase domain of ABL2 at 1.9 Å resolution in complex with the oncology drug gleevec. Interestingly, gleevec (imatinib) interacts not only with the ATP binding site but was found to bind also to the regulatory myristilation site. The structure of this complex may therefore serve as a tool for the development of allosteric ABL inhibitors

Imatinib

Materials and Methods

Entry Clone Source: MGC

Entry Clone Accession: IMAGE:5173213

SGC Construct ID: ABL2A-c055

GenBank GI number: gi|6382060

Vector: pFB-LIC-Bse. Details [ PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified construct sequence:
TACTTCCAATCCATGGACAAATGGGAAAT
GGAGCGAACAGATATTACCATGAAGCACA
AACTTGGGGGCGGTCAGTATGGAGAGGTT
TACGTTGGCGTCTGGAAGAAATACAGCCT
TACAGTTGCTGTGAAAACATTGAAGGAAG
ATACCATGGAGGTAGAAGAATTCCTGAAA
GAAGCTGCAGTAATGAAGGAAATCAAGCA
TCCTAATCTGGTACAACTTTTAGGTGTGT
GTACTTTGGAGCCACCATTTTACATTGTG
ACTGAATACATGCCATACGGGAATTTGCT
GGATTACCTCCGAGAATGCAACCGAGAAG
AGGTGACTGCAGTTGTGCTGCTCTACATG
GCCACTCAGATTTCTTCTGCAATGGAGTA
CTTAGAGAAGAAGAATTTCATCCATAGAG
ATCTTGCAGCTCGTAACTGCCTAGTGGGA
GAAAACCATGTGGTAAAAGTGGCTGACTT
TGGCTTAAGTAGATTGATGACTGGAGACA
CTTATACTGCTCATGCTGGAGCCAAATTT
CCTATTAAGTGGACAGCACCAGAGAGTCT
TGCCTACAATACCTTCTCAATTAAATCTG
ACGTCTGGGCTTTTGGGGTATTGTTGTGG
GAAATTGCTACCTATGGAATGTCACCATA
TCCAGGTATTGACCTGTCTCAGGTCTATG
ACCTACTAGAAAAAGGATATCGAATGGAA
CAGCCTGAGGGATGCCCCCCTAAGGTTTA
TGAACTTATGAGAGCATGCTGGAAGTGGA
GCCCTGCCGATAGGCCCTCTTTTGCTGAA
ACACACCAAGCTTTTGAAACCATGTTCCA
TGACTCTTGACAGTAAAGGTGGATA

Tags and additions: Cleavable N-terminal His6 tag.

Final protein sequence:
mghhhhhhssgvdlgtenlyfq^sMDKWE
MERTDITMKHKLGGGQYGEVYVGVWKKYS
LTVAVKTLKEDTMEVEEFLKEAAVMKEIK
HPNLVQLLGVCTLEPPFYIVTEYMPYGNL
LDYLRECNREEVTAVVLLYMATQISSAME
YLEKKNFIHRDLAARNCLVGENHVVKVAD
FGLSRLMTGDTYTAHAGAKFPIKWTAPES
LAYNTFSIKSDVWAFGVLLWEIATYGMSP
YPGIDLSQVYDLLEKGYRMEQPEGCPPKV
YELMRACWKWSPADRPSFAETHQAFETMF
HDS

^ TEV cleave site

Host: Baculo Virus infected Insect cells (High5 cells)

Growth medium, induction protocol:
High five cells were grown in Insect Express Medium . Cells were infected at a density of 2x106/ml with recombinant baculovirus (virus stock P2; 1ml of virus stock/100 ml of cell culture). Cells were shaken at 120 rpm at 27°C in the innova shaker. After 48 hours post-infection the cultures were collected and centrifuged for 10min at 2000rpm. The cell pellet was resuspended in cold PBS and centrifugation was repeated. Bnding buffer: 50 mM HEPES pH 7.5; 500 mM NaCl; 5 mM imidazole, 5% glycerol; 0.5 mM TCEP.

Extraction buffer, extraction method: Frozen pellets were thawed and cells lysed using a high pressure cell disrupter. PEI (polyethyleneimine) was added to the lysate to a final concentration of 0.15 % and the lysate was centrifuged at 17,000 rpm for 30 minutes and the supernatant collected for purification.

Column 1: Ni-affinity. Ni-NTA (Qiagen), 5 ml of 50% slurry in 1.5 x 10 cm column, washed with binding buffer.

Buffers: Binding buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 5% Glycerol, 0.5 mM TCEP; Wash buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 20 mM Imidazole, 5% glycerol, 0.5 mM TCEP; Elution buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 300 mM Imidazole , 5% Glycerol, 0.5 mM TCEP.

Procedure: The cleared lysate was loaded by gravity flow on the Ni-NTA column. The column was then washed with 100 ml binding buffer and 100 ml wash buffer at gravity flow. The protein was eluted by gravity flow by applying 5-ml of elution buffer.

Column 2: Size Exclusion Chromatography. Superdex S200 16/60 HiLoad.

Buffers: 10 mM HEPES, pH 7.5; 500 mM NaCl, , 5% Glycerol, 0.5 mM TCEP.

Procedure: The protein was concentrated and applied to an S200 16/60 HiLoad gel filtration column equilibrated in 10 mM HEPES, pH 7.5; 500 mM NaCl, , 5% Glycerol, 0.5 mM TCEP using ÄKTA express system.

Mass spectrometry characterization: The mass of the protein was calculated to be 33502 Da and experimentally determined mass was 33414 Da for the His tag containing protein. It is therefore likely that the difference in Mass is due to removal of the initial Met and Acetylation.

Protein concentration: Protein was concentrated to 4.0 mg/ml using an Amicon 10 kDa cut-off concentrator.

Crystallization: Diffraction quality crystals were grown at 4oC in 100 nl drops from a 1:1 ratio of protein and reservoir solution (20% PEG 3350; 0.1M citrate pH 5.5).

Data Collection: Crystals were cryo-protected using 25% EtGly; Resolution: 2.05 Å; X-ray source: Diffraction data were collected at the SLS-X10SA.

References

De Keersmaecker, K., and Cools, J. (2006). Chronic myeloproliferative disorders: a tyrosine kinase tale. Leukemia 20, 200-205.

Griesinger, F., Janke, A., Podleschny, M., and Bohlander, S.K. (2002). Identification of an ETV6-ABL2 fusion transcript in combination with an ETV6 point mutation in a T-cell acute lymphoblastic leukaemia cell line. British journal of haematology 119, 454-458.

Gu, J.J., Ryu, J.R., and Pendergast, A.M. (2009). Abl tyrosine kinases in T-cell signaling. Immunological reviews 228, 170-183.

Iijima, Y., Ito, T., Oikawa, T., Eguchi, M., Eguchi-Ishimae, M., Kamada, N., Kishi, K., Asano, S., Sakaki, Y., and Sato, Y. (2000). A new ETV6/TEL partner gene, ARG (ABL-related gene or ABL2), identified in an AML-M3 cell line with a t(1;12)(q25;p13) translocation. Blood 95, 2126-2131.

Yagasaki, F., Wakao, D., Yokoyama, Y., Uchida, Y., Murohashi, I., Kayano, H., Taniwaki, M., Matsuda, A., and Bessho, M. (2001). Fusion of ETV6 to fibroblast growth factor receptor 3 in peripheral T-cell lymphoma with a t(4;12)(p16;p13) chromosomal translocation. Cancer research 61, 8371-8374.

Yuan, B.Z., Jefferson, A.M., Popescu, N.C., and Reynolds, S.H. (2004). Aberrant gene expression in human non small cell lung carcinoma cells exposed to demethylating agent 5-aza-2'-deoxycytidine. Neoplasia (New York, NY) 6, 412-419.