Human thioredoxin reductase 3 (glutaredoxin domain)

Target ID:

TXNRD3A

Aliases:

TGRTR2TRXR3TXNRD3

Deposition Date:

Wednesday 29th April 2009

Families:

Oxidoreductases

Related Diseases:

Metabolism

Structure type:

apo

Download Coordinates:

3H8Q

Authors:

Chaikuad, A., Johansson, C., Ugochukwu, E., Roos, A.K., von Delft, F., Pilka, E., Yue, W., Arrowsmith, C.H., Edwards, A.M., Weigelt, J., Bountra, C., Oppermann, U.

Site:

Oxford

ICM Datapack:

ICM Datapack

3H8Q

tabs

Structure Details

In mammalian cells, the thioredoxin (TRX) and glutathione systems are the major systems that regulate cellular redox status and redox dependent signaling pathways. Thioredoxin reductases (TXNRDs) are homo-dimeric pyridine nucleotide disulfide oxidoreductases that are part of the thioredoxin system. Mammalian TXNRDs are in contrast to the bacterial enzymes selenoproteins with an penultimate selenocysteine in their C-terminal redox active centre. They exhibit broad substrate specificity and can apart from reducing thioredoxin, reduce protein disulfide isomerase, some glutaredoxins (GLRXs) and various low-molecular weight compounds (1).

Human cells contain three TXNRDs: the predominantly cytosolic TXNRD1 that is present in most tissues, the mitochondrial TXNRD2 and the testis specific TXNRD3. TXNRD3 is mainly expressed in male germ cells where it is proposed to have a role in the formation and isomerisation of disulfide bonds in sperm proteins during spermatogenesis (2). TXNRD3 contains in contrast to other pyridine nucleotide disulfide oxidoreductases an N-terminal GLRX domain that is fused to a TXNRD module trough a linker. GLRXs, which are small thiol-disulfide oxidoreductases, are part of the glutathione system. They regulate redox dependent signaling pathways by catalyzing the formation or reduction of mixed disulfides with glutathione but have also been linked to iron metabolism and iron –sulfur cluster biosynthesis (3). The GLRX domain in TXNRD3 is related to the dithiol glutaredoxins, it has GLRX activity and can receive electrons from either the TXNRD domain, TXNRD1 or glutathione (4). This domain gives TXNRD3 the unique capacity to catalyse reactions specific for both the thioredoxin and the glutathione redox systems.

We determined the crystal structure of the GLRX domain in human TXNRD3 at 2.0 Å resolution. The structure reveals a canonical thioredoxin fold, highly similar to the dithiols GLRXs.

Materials and Methods

Entry Clone Source: Ordered-synthetic

Entry Clone Accession: n/a

SGC Construct ID: TXNRD3A-c136

GenBank GI number: gi|51492609

Vector: pNIC-CTHF. Details [ PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified construct sequence:
CTTAAGAAGGAGATATACTATGGCGCGCG
AAGAACTGCGTCGTCATCTGGTTGGACTG
ATTGAGCGCTCCCGTGTGGTAATCTTTTC
AAAGTCTTATTGTCCGCATAGTACGCGTG
TTAAAGAACTGTTTTCCAGCCTGGGTGTA
GAATGCAATGTGCTGGAGCTGGACCAGGT
GGATGATGGTGCCCGCGTTCAGGAAGTCC
TGTCTGAAATTACCAACCAGAAAACGGTC
CCGAACATTTTCGTGAATAAAGTGCACGT
CGGTGGCTGCGATCAGACTTTTCAGGCAT
ATCAGAGTGGGCTGCTGCAGAAACTGCTG
CAAGAAGACCTGGCCTATGATGCAGAGAA
CCTCTACTTCCAATCGCACCATCATCACC
ACCATGATTACAAGGATGACGACGATAAG
TGAGGATCC

Tags and additions: TEV-cleavable (*), C-terminal histag. Tag sequence: aenlyfq*shhhhhhdykddddk

Protein sequence (after TEV cleavage; tag sequence in lowercase):
MAREELRRHLVGLIERSRVVIFSKSYCPH
STRVKELFSSLGVECNVLELDQVDDGARV
QEVLSEITNQKTVPNIFVNKVHVGGCDQT
FQAYQSGLLQKLLQEDLAYDaenlyfq

Host: ORIGAMI2

Growth medium, induction protocol: Medium: TB, 50 µg/ml Kanamycin and 10 µg/ml tetracycline. 2x2 liter TB in 5-L flasks were inoculated with 3x20 ml overnight culture and grown at 37°C until OD₆₀₀ reached 2.5 . The temperature was then decreased to 18°C and the protein expression induced with 0.1 mM IPTG over night . The cells were collected by centrifugation and frozen at -80°C.

Extraction buffer, extraction method: Lysis buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 10 mM Imidazole, 5% glycerol, 0.5 mM TCEP, 1 mM PMSF and 3 U/ml of Benzonase. Cell pellets were resuspended in a total volume of 250 ml lysis buffer. The cells were disrupted by high pressure (15 kpsi) and nucleic acids and cell debris removed by adding 0.15% PEI, followed by centrifugation for 60 minutes at 40000xg. The supernatant was further clarified by filtration (0.20 µm).

Column 1: Ni-Sepharose FF, 3 ml (GE/Amersham Biosciences )

Buffers: Binding buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 10 mM Imidazole, 5% glycerol , 0.5 mM TCEP; Wash and elution buffers: 50 mM HEPES pH 7.5, 500 mM NaCl, 5% glycerol 10-250 mM imidazole.

Procedure: The cell lysate was applied onto a 3 ml Ni-Sepharose FF column equilibrated with binding buffer. The column was subsequently washed with 30 ml of binding buffer and the protein eluted using a stepwise gradient of imidazole. All fractions were collected and analysed by SDS-PAGE.

Column 2: Hiload 16/60 Superdex 200 prep grade 120 ml (GE/Amersham Biosciences).

Buffers: 10 mM HEPES, pH 7.5, 500 mM NaCl, 5% glycerol, 0.5 mM TCEP.

Procedure: The fractions eluted from the Ni-affinity chromatography were incubated with 0.5 mM TCEP and concentrated in amicon (3K) to 5 ml. The protein was filtered through a 0.20 µm PVDF filter and applied to a Superdex S200 column at 1 ml/min. The eluted proteins were collected in 1.8 ml fractions and analysed by SDS-PAGE.

Enzymatic treatment: TEV cleavage.

Column 3: Ni-Sepharose FF (TEV clean up)

Buffer: 10 mM HEPES, pH 7.5, 500 mM NaCl, 5% glycerol

Procedure: The Histidine-tag was cleaved with 150 µg of TEV protease per 10 mg protein at 4°C for 16 hours. The TEV cleaved protein was applied to a 0.5 ml Ni-sepharose column and the flow through collected. The column was washed with 5 ml buffer and the flow through and the wash fraction were analysed by SDS-PAGE.

Concentration: The protein was concentrated in Amicon (3 K) to 12.3 mg/ml. The protein concentration was determined spectrophotometrically using the predicted molar extinction coefficient 5960 (M^-1 cm^-1).

Mass spectrometry characterization: Two peaks of 13017.0 and 12886.1 Da were determined by ES-TOF for TXNRD3Ap005 which correspond respectively to the expected mass of the construct (13016.8 Da) and the protein lacking the N-terminal methionine (12885.8)

Crystallisation: The GLRX domain in TXNRD3A was crystallised by vapor diffusion at 20ºC in a sitting drop consisting of 100 nL protein (12.3 mg/ml) and 50 nL well solution. The drop was equilibrated against well solution containing 0.1 M Hepes pH 7.5, 2 M (NH₄)₂SO₄. The crystal was transferred to a cryoprotectant composed of 20% ethylene glycol before flash-cooling in liquid nitrogen.

Data Collection: Resolution: 2.2 Å; X-ray source: Synchrontron SLS-X10.

Data Processing: Data were processed and scaled using MOSFLM and SCALA. Initial structure solution was obtained by molecular replacement using the program PHASER and the coordinate of glutaredoxin C1 of from populus tremula x tremuloides (pdb id: 2e7p) as a search model. Phases were improved by applying NCS averaging and solvent flattening using the program Parrot. Automated model building was performed using the program Buccaneer. The model was refined using REFMAC5 with manual rebuilding in COOT. The final model was refined against 2.21 Å with the final R_fact of 0.189 and R_free of 0.233.