Human type I activin receptor (kinase domain) in complex with FKBP12 and dorsomorphin

Target ID:

XX01ACVR1A

Deposition Date:

Thursday 30th April 2009

Families:

Protein Kinase

Structure type:

protein-protein

Download Coordinates:

3H9R

Authors:

Chaikuad, A., Alfano, I., Shrestha, B., Muniz, J., Petrie, K., Fedorov, O., Phillips, C., Bishop, S., Mahajan, P., Pike, A.C.W., von Delft, F., Arrowsmith, C.H., Edwards, A.M., Weigelt, J., Bountra, C., Knapp, S., Bullock, A.

Site:

Oxford

ICM Datapack:

ICM Datapack

3H9R

tabs

Structure Details

ACVR1 (also known as ALK2, ActRIA and Tsk7L) belongs to the bone morphogenetic protein (BMP) receptor family of transmembrane serine/threonine kinases. Secreted BMPs, which are members of the TGF-beta superfamily involved in endochondral bone formation and embryogenesis, induce heteromeric assembly of type II and type I receptors. Five type II and seven type I receptors, also termed activin-receptor like kinases (ALK1-7) are identified in mammals. All ALKs have a similar sequence and domain structure composed of a ligand-binding extracellular domain, a transmembrane domain, and a cytoplasmic kinase domain (ten Dijke et al., 1993). The type II receptor functions to activate the type I receptor by phosphorylation of its glycine-serine rich (GS) domain. Subsequently, the type I receptor binds and phosphorylates members of the SMAD family of transcription factors. Binding of FKBP12 to the GS domains stabilizes the inactive confirmation of type I receptor and thus prevents leaky activation (Bocciardi et al., 2009; Graham and Peng, 2006).

Mouse models have shown the importance of ACVR1 for cardiac, lens and skeletal development, epithelial-mesenchymal transformation, Müllerian duct regression, generation of primordial gem cells and also for normal mesoderm formation in extraembryonic tissues at the time of gastrulation (Rajagopal et al., 2008; Yu et al., 2008) (Fukuda et al., 2006; Komatsu et al., 2007) (Wang et al., 2005) (de Sousa Lopes et al., 2004; Kaartinen et al., 2004) (Dudas et al., 2004) (Gu et al., 1999) (Mishina et al., 1999) (Ameerun et al., 1996) (Verschueren et al., 1995). Homozygous mutant mice of ACVR1 show morphological defects at E7.0 and have died by E9.5.

A single mutation of 617G-A resulting in an R206 to H conversion in the GS domain of ACVR1 is the primary cause of fibrodysplasia ossificans progressiva (FOP), a rare autosomal dominant disorder of skeletal malformations and progressive extraskeletal ossification (Shore et al., 2006). Affected individuals show heterotopic ossification in childhood, which can be induced by trauma or may occur without warning. Bone formation is episodic and progressive, leading to extra-articular ankylosis of all major joints of the axial and appendicular skeleton, rendering movement impossible. The kinase inhibitor dorsomorphin binds ACVR1 and offers a lead for drug discovery.

Here we present the structure of the GS and kinase domains of ACVR1 in complex with FKBP12 and dorsomorphin refined at 2.35Å resolution.

Materials and Methods

Entry Clone Source: Five Prime

Entry Clone Accession: n/a

SGC Construct ID: ACVR1A-c076

GenBank GI number: gi|4501895

Vector: pFB-LIC-Bse. Details [ PDF ]; Sequence [ FASTA ] or [ GenBank ]

Entry clone accession/ sequence:
CCATGGGCCACCATCATCATCATCATTCT
TCTGGTGTAGATCTGGGTACCGAGAACCT
GTACTTCCAATCCATGACCACCAATGTTG
GAGACAGCACTTTAGCAGATTTATTGGAT
CATTCGTGTACATCAGGAAGTGGCTCTGG
TCTTCCTTTTCTGGTACAAAGAACAGTGG
CTCGCCAGATTACACTGTTGGAGTGTGTC
GGGAAAGGCAGGTATGGTGAGGTGTGGAG
GGGCAGCTGGCAAGGGGAAAATGTTGCCG
TGAAGATCTTCTCCTCCCGTGATGAGAAG
TCATGGTTCAGGGAAACGGAATTGTACAA
CACTGTGATGCTGAGGCATGAAAATATCT
TAGGTTTCATTGCTTCAGACATGACATCA
AGACACTCCAGTACCCAGCTGTGGTTAAT
TACACATTATCATGAAATGGGATCGTTGT
ACGACTATCTTCAGCTTACTACTCTGGAT
ACAGTTAGCTGCCTTCGAATAGTGCTGTC
CATAGCTAGTGGTCTTGCACATTTGCACA
TAGAGATATTTGGGACCCAAGGGAAACCA
GCCATTGCCCATCGAGATTTAAAGAGCAA
AAATATTCTGGTTAAGAAGAATGGACAGT
GTTGCATAGCAGATTTGGGCCTGGCAGTC
ATGCATTCCCAGAGCACCAATCAGCTTGA
TGTGGGGAACAATCCCCGTGTGGGCACCA
AGCGCTACATGGCCCCCGAAGTTCTAGAT
GAAACCATCCAGGTGGATTGTTTCGATTC
TTATAAAAGGGTCGATATTTGGGCCTTTG
GACTTGTTTTGTGGGAAGTGGCCAGGCGG
ATGGTGAGCAATGGTATAGTGGAGGATTA
CAAGCCACCGTTCTACGATGTGGTTCCCA
ATGACCCAAGTTTTGAAGATATGAGGAAG
GTAGTCTGTGTGGATCAACAAAGGCCAAA
CATACCCAACAGATGGTTCTCAGACCCGA
CATTAACCTCTCTGGCCAAGCTAATGAAA
GAATGCTGGTATCAAAATCCATCCGCAAG
ACTCACAGCACTGCGTATCAAAAAGACTT
TGACCAAAATTGATTGACAGTAAAGGTGG
ATACGGATCCGAATTCGAGCTCCGTCGAC
AAGCTT

Tags and additions: mghhhhhhssgvdlgtenlyfq*sM - cleavable N-terminal hexahistidine tag.

Expressed protein sequence (tag sequence in lowercase):
mghhhhhhssgvdlgtenlyfqsMTTNVG
DSTLADLLDHSCTSGSGSGLPFLVQRTVA
RQITLLECVGKGRYGEVWRGSWQGENVAV
KIFSSRDEKSWFRETELYNTVMLRHENIL
GFIASDMTSRHSSTQLWLITHYHEMGSLY
DYLQLTTLDTVSCLRIVLSIASGLAHLHI
EIFGTQGKPAIAHRDLKSKNILVKKNGQC
CIADLGLAVMHSQSTNQLDVGNNPRVGTK
RYMAPEVLDETIQVDCFDSYKRVDIWAFG
LVLWEVARRMVSNGIVEDYKPPFYDVVPN
DPSFEDMRKVVCVDQQRPNIPNRWFSDPT
LTSLAKLMKECWYQNPSARLTALRIKKTL
TKID

Host: SF9 Spodoptera frugiperda Insect cells

Growth medium, induction protocol: Cells at the density of 2 million/ml were infected. Cells were harvested by centrifugation at 4500 rpm at 4°C for 15 min. Cell pellets from each 1lt flask were resuspended in 20 ml binding buffer (50 mM Hepes, pH 7.5; 500 mM NaCl; 5% Glycerol; 5 mM imidazole), transferred to 50 ml tubes, and stored at -20°C.

Extraction buffer, extraction method: The frozen cells were thawed and 1/100 mix Calbiochem protease inhibitor SET V was added to the cell suspension. The cells were lysed using an Emulsiflex C3 homogeniser. The cell lysate was spun down by centrifugation at 21K rpm and 4°C for 1 h. The supernatant was recovered for purification.

Column 1: Anion-exchange for Nucleic acid removal with DEAE cellulose (DE52, Whatmann) 10 g of resin was suspended in 50 ml 0.3 M NaCl, and then applied onto a 2.5 x 20 cm column. The resin was then equilibrated with 50 ml binding buffer prior to loading the sample.

Procedure: The supernatant was first applied onto the column by gravity flow, which was followed by a wash with 100 ml wash buffer. The column flow-through and wash was directly applied onto a Ni-IDA column.

Column 2: Ni-Affinity Chromatography. 5 ml of 50 % Ni-IDA slurry was applied onto a 1.5 x 10 cm column. The column was equilibrated with binding buffer (25ml).

Buffers: Binding buffer: 50 mM Hepes, pH 7.5; 500 mM NaCl; 5% Glycerol; 5 mM imidazole, 0.1mM TCEP; Wash buffer: 50 mM Hepes, pH 7.5; 500 mM NaCl; 5% Glycerol; 25 mM imidazole, 0.1mM TCEP; Elution buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% Glycerol; 50 to 250 mM imidazole, 0.1mM TCEP.

Procedure: The flow-through from column 1 (DE52) was applied by gravity flow onto the Ni-IDA column. The bound protein was eluted by applying a step gradient of imidazole – using 12 ml portions of elution buffer with increasing concentration of imidazole (50 mM, 100 mM, 150 mM, 250 mM).

Enzymatic treatment: 0.1mg of TEV protease was added to the Ni-eluted protein to remove the tag.

Complex Assembly: 5mg of ACVR1A and 5mg of FKBP12 (see below for FKBP12 methods) were incubated at 4°C for 30 minutes.

Column 3: Size Exclusion Chromatography – S200 HiLoad 16/60 Superdex run on ÄKTA-Express.

Buffer: Gel Filtration buffer: 300 mM NaCl, 50 mM Hepes pH 7.5, 05mM TCEP.

Procedure: Prior to applying the protein, the S200 16/60 column was washed and equilibrated with gel filtration buffer. The two proteins were mixed and concentrated to 3 ml using an Amicon Ultra-15 filter with a 10 kDa cut-off. The concentrated protein was directly applied onto the equilibrated S200 16/60 column, and run at a flow-rate of 1 ml/min. The protein was eluted at 80 – 95 ml. Fractions containing the protein were pooled together.

Mass spec characterization: The purified protein was homogeneous and had an experimental mass of 37.353 and 12.037 kDa, as expected from primary sequences. Masses were determined by LC-MS, using an Agilent LC/MSD TOF system with reversed-phase HPLC coupled to electrospray ionisation and an orthogonal time-of-flight mass analyser. Proteins were desalted prior to mass spectrometry by rapid elution off a C3 column with a gradient of 5-95% acetonitrile in water with 0.1% formic acid.

MATERIALS & METHODS FOR FKBP12 PRIOR TO COMPLEX FORMATION

Entry Clone Source: MGC

Entry Clone Accession: IMAGE:3504715

SGC Construct ID: FKBP1AA-c001

GenBank GI number: gi|4503725

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Entry clone accession/ sequence:
ATGGGAGTGCAGGTGGAAACCATCTCCCC
AGGAGACGGGCGCACCTTCCCCAAGCGCG
GCCAGACCTGCGTGGTGCACTACACCGGG
ATGCTTGAAGATGGAAAGAAATTTGATTC
CTCCCGGGACAGAAACAAGCCCTTTAAGT
TTATGCTAGGCAAGCAGGAGGTGATCCGA
GGCTGGGAAGAAGGGGTTGCCCAGATGAG
TGTGGGTCAGAGAGCCAAACTGACTATAT
CTCCAGATTATGCCTATGGTGCCACTGGG
CACCCAGGCATCATCCCACCACATGCCAC
TCTCGTCTTCGATGTGGAGCTTCTAAAAC
TGGAATGA

Tags and additions: mhhhhhhssgvdlgtenlyfq*sM - cleavable N-terminal hexahistidine tag.

Expressed protein sequence:
mhhhhhhssgvdlgtenlyfqsMGVQVET
ISPGDGRTFPKRGQTCVVHYTGMLEDGKK
FDSSRDRNKPFKFMLGKQEVIRGWEEGVA
QMSVGQRAKLTISPDYAYGATGHPGIIPP
HATLVFDVELLKLE

Host: BL21(DE3)-R3-pRARE2

Growth medium, induction protocol: A glycerol stock was used to inoculate a 50 ml starter culture containing LB media and 34 µg/ml chloramphenicol and 50 µg/ml kanamycin. The starter culture was grown overnight at 37°C with shaking at 250 rpm. A flask containing 1L LB media with 34 µg/ml chloramphenicol and 50 µg/ml kanamycin was inoculated with 5 ml of the starter culture. The 1L culture was incubated at 37°C with shaking at 180 rpm until an OD600nm ≥ 0.5 was reached. The flasks were then cooled down to 18°C and 0.5 mM IPTG added to induce protein expression overnight. Cells were harvested by centrifugation at 4500 rpm at 4°C for 15 min. The cell pellet was resuspended in 30 ml binding buffer (50 mM Hepes, pH 7.5; 500 mM NaCl; 5% Glycerol; 5 mM imidazole), transferred to a 50 ml tube, and stored at -20°C.

Extraction buffer, extraction method: The frozen cells were thawed and 0.5 mM TCEP and 1 mM PMSF were added to the cell suspension. The cells were lysed by sonication over 12 min with the sonicator pulsing ON for 5 sec and OFF for 15 sec. The cell lysate was spun down by centrifugation at 16.5k rpm and 4°C for 1 h. The supernatant was recovered for purification.

Columns 1 and 2: FKBP12 was purified from the supernatant using the same column 1/column 2 protocol as shown above for ACVR1. The two proteins were mixed as described above before further purification as described above.

Enzymatic treatment: 0.1mg of TEV protease was added to the Ni-eluted protein to remove the tag.

Crystallisation of the ACVR1-FKBP12 complex: Protein was buffered in 50 mM HEPES, pH 7.5, 150 mM NaCl, 10 mM DTT. To this 1mM dorosomorphin was added and the protein concentrated to 10 mg/ml (calculated using an extinction co-efficient of 46870). Crystals were grown at 4°C in 150 nl sitting drops mixing 100 nl protein solution with 50 nl of a reservoir solution containing 30% PEG3350, 0.25 M (NH4)2SO4, 0.1M BisTris pH 6.0. On mounting crystals were cryoprotected with mother liquor plus 20% PEG400 and flash frozen in liquid nitrogen.

Data Collection: Resolution: 2.35 Å resolution; X-ray source: Diamond Light Source, station I02, using monochromatic radiation at wavelength 0.9050 Å

References

Ameerun, R.F., de Winter, J.P., van den Eijnden-van Raaij, A.J., den Hertog, J., de Laat, S.W., and Tertoolen, L.G. (1996). Activin and basic fibroblast growth factor regulate neurogenesis of murine embryonal carcinoma cells. Cell Growth Differ 7, 1679-1688.

Bocciardi, R., Bordo, D., Di Duca, M., Di Rocco, M., and Ravazzolo, R. (2009). Mutational analysis of the ACVR1 gene in Italian patients affected with fibrodysplasia ossificans progressiva: confirmations and advancements. Eur J Hum Genet 17, 311-318.

de Sousa Lopes, S.M., Roelen, B.A., Monteiro, R.M., Emmens, R., Lin, H.Y., Li, E., Lawson, K.A., and Mummery, C.L. (2004). BMP signaling mediated by ALK2 in the visceral endoderm is necessary for the generation of primordial germ cells in the mouse embryo. Genes & development 18, 1838-1849.

Dudas, M., Sridurongrit, S., Nagy, A., Okazaki, K., and Kaartinen, V. (2004). Craniofacial defects in mice lacking BMP type I receptor Alk2 in neural crest cells. Mechanisms of development 121, 173-182.

Fukuda, T., Scott, G., Komatsu, Y., Araya, R., Kawano, M., Ray, M.K., Yamada, M., and Mishina, Y. (2006). Generation of a mouse with conditionally activated signaling through the BMP receptor, ALK2. Genesis 44, 159-167.

Graham, H., and Peng, C. (2006). Activin receptor-like kinases: structure, function and clinical implications. Endocrine, metabolic & immune disorders drug targets 6, 45-58.

Gu, Z., Reynolds, E.M., Song, J., Lei, H., Feijen, A., Yu, L., He, W., MacLaughlin, D.T., van den Eijnden-van Raaij, J., Donahoe, P.K., et al. (1999). The type I serine/threonine kinase receptor ActRIA (ALK2) is required for gastrulation of the mouse embryo. Development (Cambridge, England) 126, 2551-2561.

Kaartinen, V., Dudas, M., Nagy, A., Sridurongrit, S., Lu, M.M., and Epstein, J.A. (2004). Cardiac outflow tract defects in mice lacking ALK2 in neural crest cells. Development (Cambridge, England) 131, 3481-3490.

Komatsu, Y., Scott, G., Nagy, A., Kaartinen, V., and Mishina, Y. (2007). BMP type I receptor ALK2 is essential for proper patterning at late gastrulation during mouse embryogenesis. Dev Dyn 236, 512-517.

Mishina, Y., Crombie, R., Bradley, A., and Behringer, R.R. (1999). Multiple roles for activin-like kinase-2 signaling during mouse embryogenesis. Developmental biology 213, 314-326.

Rajagopal, R., Dattilo, L.K., Kaartinen, V., Deng, C.X., Umans, L., Zwijsen, A., Roberts, A.B., Bottinger, E.P., and Beebe, D.C. (2008). Functions of the type 1 BMP receptor Acvr1 (Alk2) in lens development: cell proliferation, terminal differentiation, and survival. Investigative ophthalmology & visual science 49, 4953-4960.

Shore, E.M., Xu, M., Feldman, G.J., Fenstermacher, D.A., Cho, T.J., Choi, I.H., Connor, J.M., Delai, P., Glaser, D.L., LeMerrer, M., et al. (2006). A recurrent mutation in the BMP type I receptor ACVR1 causes inherited and sporadic fibrodysplasia ossificans progressiva. Nature genetics 38, 525-527.

ten Dijke, P., Ichijo, H., Franzen, P., Schulz, P., Saras, J., Toyoshima, H., Heldin, C.H., and Miyazono, K. (1993). Activin receptor-like kinases: a novel subclass of cell-surface receptors with predicted serine/threonine kinase activity. Oncogene 8, 2879-2887.

Verschueren, K., Dewulf, N., Goumans, M.J., Lonnoy, O., Feijen, A., Grimsby, S., Vandi Spiegle, K., ten Dijke, P., Moren, A., Vanscheeuwijck, P., et al. (1995). Expression of type I and type IB receptors for activin in midgestation mouse embryos suggests distinct functions in organogenesis. Mechanisms of development 52, 109-123.

Wang, J., Sridurongrit, S., Dudas, M., Thomas, P., Nagy, A., Schneider, M.D., Epstein, J.A., and Kaartinen, V. (2005). Atrioventricular cushion transformation is mediated by ALK2 in the developing mouse heart. Developmental biology 286, 299-310.

Yu, P.B., Deng, D.Y., Lai, C.S., Hong, C.C., Cuny, G.D., Bouxsein, M.L., Hong, D.W., McManus, P.M., Katagiri, T., Sachidanandan, C., et al. (2008). BMP type I receptor inhibition reduces heterotopic [corrected] ossification. Nature medicine 14, 1363-1369.