Human bromodomain containing 9

Target ID:

BRD9A

Aliases:

BRD9DKFZp434D0711DKFZp686L0539LAVS3040PRO9856

Deposition Date:

Friday 29th May 2009

Families:

Bromodomain

Related Diseases:

Chromatin and epigenetics

Structure type:

apo

Download Coordinates:

3HME

Authors:

Filippakopoulos, P., Eswaran, J., Keates, T., Picaud, S., Roos, A., Chaikuad, A., von Delft, F., Arrowsmith, C.H., Edwards, A., Weigelt, J., Bountra, C., Knapp, S.

Site:

Oxford

3HME

tabs

Structure Details

Bromodomains interact with acetylated lysine and have been originally identified as domains in chromatin-associated proteins and histone acetyl transferases (Mujtaba et al., 2007). BRD9 together with BRD7 forms an independent branch of the phyllogenetic tree of bromo domains.

Little is known about the biological function of BRD9 but it has been associated with a number of different cancer types. BRD9 has been identified as an antigen in sarcoma and is one of the genes differentially over-expressed in cervical carcinoma (Scotto et al., 2008). The gene for BRD9 is located on chromosome 5p, in a region that has been found to be frequently altered in non-small cell lung cancer (Kang et al., 2008). Here we report the structure of the BRD9A bromo domain at 2.23 Å resolution.

Materials and Methods

Entry Clone Source: Synthetic

Entry Clone Accession: n/a

SGC Construct ID: BRD9A-c006

GenBank GI number: gi|57770383

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified construct sequence:
CATATGCACCATCATCATCATCATTCTTC
TGGTGTAGATCTGGGTACCGAGAACCTGT
ACTTCCAATCCATGCTGAAACTGAGCGCG
GAAAATGAAAGCACCCCGATTCAGCAGCT
GCTGGAACATTTCCTGCGCCAGCTGCAGC
GTAAAGATCCGCATGGCTTTTTTGCGTTC
CCGGTGACCGATGCGATTGCGCCGGGTTA
TAGCATGATTATTAAACATCCGATGGATT
TTGGTACCATGAAAGATAAAATCGTGGCG
AATGAATATAAAAGCGTGACCGAATTTAA
AGCCGATTTCAAACTGATGTGCGATAACG
CGATGACCTATAACCGTCCGGATACCGTG
TATTATAAACTGGCCAAAAAAATTCTGCA
TGCGGGTTTTAAAATGATGAGCAAAGAAC
GTCTGCTGGCCCTGAAACGCAGCATGAGC
TGACAGTAAAGGTGGATACGGATCCGAA

Tags and additions: Cleavable N-terminal His6 tag.

Final protein sequence:
mhhhhhhssgvdlgtenlyfq^sMLKLSA
ENESTPIQQLLEHFLRQLQRKDPHGFFAF
PVTDAIAPGYSMIIKHPMDFGTMKDKIVA
NEYKSVTEFKADFKLMCDNAMTYNRPDTV
YYKLAKKILHAGFKMMSKERLLALKRSMS

^ TEV cleave site

Host: BL21 (DE3)R3-pRARE2 (Phage resistant strain)

Growth medium, induction protocol: 5 ml from a 50 ml overnight culture containing 50 µg/ml kanamycin and 34 µg/ml chloramphenicol were used to inoculate each of two 1 litre cultures of LB containing 50 µg/ml kanamycin and 34 µg/ml chloramphenicol. Cultures were grown at 37°C until the OD₆₀₀ reached ~0.5 then the temperature was adjusted to 18°C. Expression was induced overnight using 0.5 mM IPTG at an OD₆₀₀ of 0.9. The cells were collected by centrifugation and the pellet resuspended in binding buffer and frozen. Binding buffer: 50 mM HEPES pH 7.5; 500 mM NaCl; 5 mM imidazole, 5% glycerol.

Extraction buffer, extraction method: Frozen pellets were thawed and fresh 0.5mM TCEP, 1mM PMSF added to the lysate. Cells were lysed using sonication. The lysate was centrifuged at 16,500 rpm for 60 minutes and the supernatant collected for purification.

Column 1: Ion exchange - Nucleic acid removal. DEAE cellulose (DE52, Whatman), 10 g of resin in 2.5 x 20 cm column. The resin was hydrated in 2.5M NaCl, then washed with 20 ml binding buffer prior to loading the sample.

Buffers: 50mM HEPES pH 7.5; 500 mM NaCl; 5 mM imidazole, 5% glycerol

Procedure: Supernatant was applied by gravity flow, followed by a wash with 50 ml binding buffer. The column flow-through was collected.

Column 2: Ni-affinity. Ni-sepharose (Amersham), 5 ml of 50% slurry in 1.5 x 10 cm column, washed with binding buffer.

Buffers : Binding buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 5 mM imidazole, 5% Glycerol; Wash buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 30 mM Imidazole, 5% glycerol; Elution buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 50 to 250 mM Imidazole , 5% Glycerol (step elution).

Procedure: The flowthrough from column 1 was loaded by gravity flow on the Ni-sepharose column. The column was then washed with 30 ml wash buffer at gravity flow. The protein was eluted by gravity flow by applying 5-ml portions of elution buffer with increasing concentration of imidazole (50 mM, 100 mM, 150 and 250 mM); fractions were collected until essentially all protein was eluted. 10 mM DTT was added for overnight storage.

Enzymatic treatment : The N-terminal His tag was cleaved by treatment with TEV protease

Column 3: Size Exclusion Chromatography. Superdex S200 16/60 HiLoad

Buffers: 25 mM HEPES, pH 7.5; 300 mM NaCl, 0.5 mM TCEP

Procedure: BRD9 was concentrated and applied to an S200 16/60 HiLoad gel filtration column equilibrated in 25mM HEPES, pH 7.5; 300mM NaCl, 0.5 mM TCEP using an ÄKTAexpress system.

Column 3: Ni-affinity. Ni-sepharose (Amersham), 2 ml of 50% slurry in a Bio-rad poly-prep column, washed with binding buffer.

Buffers : Binding buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 5 mM imidazole, 5% Glycerol; Wash buffer: 25 mM HEPES pH 7.5, 300 mM NaCl, 0.5 mM TCEP; Elution buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 250 mM Imidazole , 5% Glycerol.

Procedure: Gel filtration fractions containing BRD9 were pooled and loaded by gravity flow on the Ni-sepharose column. After loading a further 4 ml of binding buffer was added and the full flow through was collected. The column was then washed with 5 ml wash buffer at gravity flow. Finally, 6 ml of elution buffer was added. Flow through, wash and elution fractions were analysed by SDS PAGE. The TEV-cleaved BRD9 protein was mainly found in the wash fraction. 10 mM DTT was added for overnight storage.

Mass spectrometry characterization: LC- ESI -MS TOF gave a measured mass of 14227 for this construct as predicted from the sequence of this protein.

Protein concentration: Protein was concentrated to 15.5 mg/ml using an Amicon 3 kDa cut-off concentrator.

Crystallization: Crystals were grown at 4°C in 150 nl sitting drops from a 2:1 ratio of protein to reservoir solution containing 25 % PEG3350, 0.17 M (NH₄)₂SO₄, 15 % glycerol.

Data Collection: Crystals were cryo-protected using the well solution and flash frozen in liquid nitrogen; X-ray source: Diffraction data were collected from a single crystal on a Rigaku FR-E SuperBright at a single wavelength of 1.5 Å and the structure was refined to 2.2 Å; Phasing: The structure was solved by molecular replacement using an ensemble of known bromodomain structures as a starting model.

References

Kang, J.U., Koo, S.H., Kwon, K.C., Park, J.W., and Kim, J.M. (2008). Gain at chromosomal region 5p15.33, containing TERT, is the most frequent genetic event in early stages of non-small cell lung cancer. Cancer genetics and cytogenetics 182, 1-11.

Mujtaba, S., Zeng, L., and Zhou, M.M. (2007). Structure and acetyl-lysine recognition of the bromodomain. Oncogene 26, 5521-5527.

Scotto, L., Narayan, G., Nandula, S.V., Subramaniyam, S., Kaufmann, A.M., Wright, J.D., Pothuri, B., Mansukhani, M., Schneider, A., Arias-Pulido, H., et al. (2008). Integrative genomics analysis of chromosome 5p gain in cervical cancer reveals target over-expressed genes, including Drosha. Molecular cancer 7, 58.