Human E1A binding protein p300 (bromodomain)

Target ID:

EP300A

Aliases:

EP300KAT3Bp300

Deposition Date:

Tuesday 30th June 2009

Families:

Bromodomain

Related Diseases:

CancerMetabolismChromatin and epigeneticsSignallingNeurobiology

Structure type:

apo

Download Coordinates:

3I3J

Authors:

Filippakopoulos, P., Picaud, S., Philips, C., Pike, A.C.W., Muniz, J., Roos, A., Chaikuad, A., von Delft, F., Arrowsmith, C.H., Edwards, A.M., Weigelt, J., Bountra, C., Knapp, S.

Site:

Oxford

3I3J

tabs

Structure Details

EP300, originally identified as a factor binding to the adenoviral E1A protein, is a ubiquitously expressed protein important for a variety of processes including cell proliferation, myogenic and hematopoietic differentiation, genomic stability, metabolic processes and response to viral infection. The central role of EP300 is reflected by the phenotype of the EP300 knockout mice, which die in utero due to defects in neurulation, cell proliferation, and heart development. Also EP300 heterozygotes manifest considerable embryonic lethality (Yao et al., 1998) (Kalkhoven, 2004).

EP300 acts as a general transcriptional coactivator and acetylates histones as well as non –histone proteins. Acetylation of non-histone proteins can have a positive or negative effect on transcriptional regulation by affecting protein- protein interaction, protein-DNA interaction, nuclear retention or protein half-life of these molecules (Kalkhoven, 2004).

Mutations in the EP300 gene can lead to Rubinstein-Taybi syndrome (RTS), a rare human genetic disorder characterized by mental retardation and physical abnormalities (Roelfsema and Peters, 2007). EP300 is thought to act as a tumor suppressor and mutations in the EP300 gene have been found in many tumor types (Chan and La Thangue, 2001). In addition p300 is a target of transforming DNA viruses like adenovirus, SV40 or human papillomavirus (Goodman and Smolik, 2000).

EP300 is a multidomain protein consisting of three cysteine-histidine-rich domains (CH1, CH2, CH3) ), of which the most carboxy-terminal region interacts specifically with E1A, a KIX domain acting as binding site for the CREB transcription factor, a bromodomain, a PHD type zinc finger, a histone acetyltransferase (HAT) domain, and a C-terminal glutamine-rich domain (Blobel, 2002). Here we report the structure of the bromodomain of EP300 at 2.3 Å resolution.

Materials and Methods

Entry Clone Source: Synthetic

Entry Clone Accession: n/a

SGC Construct ID: EP300A-c004

GenBank GI number: gi|50345997

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified construct sequence:
TACTTCCAATCCATGGCGCCGGGCCAGAG
CAAAAAAAAAATTTTCAAACCGGAAGAAC
TGCGTCAGGCCCTGATGCCGACCCTGGAA
GCCCTGTATCGTCAGGATCCGGAAAGCCT
GCCGTTTCGCCAGCCGGTGGATCCGCAGC
TGCTGGGTATCCCGGATTATTTTGATATT
GTTAAAAGCCCGATGGATCTGAGCACCAT
TAAACGTAAACTGGATACCGGCCAGTATC
AGGAACCGTGGCAGTATGTTGATGATATT
TGGCTGATGTTTAATAATGCGTGGCTGTA
TAATCGCAAAACCAGCCGCGTTTATAAAT
ATTGTAGCAAACTGAGCGAAGTGTTTGAA
CAGGAAATTGATCCGGTGATGCAGAGCCT
GGGCTGACAGTAAAGGTGGATA

Tags and additions: Cleavable N-terminal His6 tag.

Final protein sequence (tag sequence in lowercase):
mhhhhhhssgvdlgtenlyfq^sMAPGQS
KKKIFKPEELRQALMPTLEALYRQDPESL
PFRQPVDPQLLGIPDYFDIVKSPMDLSTI
KRKLDTGQYQEPWQYVDDIWLMFNNAWLY
NRKTSRVYKYCSKLSEVFEQEIDPVMQSL
G
^ TEV cleave site

Host: BL21 (DE3)R3-pRARE2 (Phage resistant strain)

Growth medium, induction protocol: 10 ml from a 50 ml overnight culture containing 50 µg/ml kanamycin and 34 µg/ml chloramphenicol were used to inoculate each of two 1 litre cultures of TB containing 50 µg/ml kanamycin and 34 µg/ml chloramphenicol. Cultures were grown at 37°C until the OD₆₀₀ reached ~2.5 then the temperature was adjusted to 18°C. Expression was induced overnight using 0.1 mM IPTG at an OD₆₀₀ of 3.0. The cells were collected by centrifugation and the pellet resuspended in binding buffer and frozen. Binding buffer: 50 mM HEPES pH 7.5; 500 mM NaCl; 10 mM imidazole.

Extraction buffer, extraction method: Frozen pellets were thawed and fresh 0.5 mM TCEP, 1 mM PMSF added to the lysate. Cells were lysed using sonication. The lysate was centrifuged at 16,500 rpm for 60 minutes and the supernatant collected for purification.

Column 1: Ni-affinity. Ni-sepharose (Amersham), 5 ml of 50% slurry in 1.5 x 10 cm column, washed with binding buffer.

Buffers: Binding buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 10 mM imidazole; Wash buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 30 mM Imidazole; Elution buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 50 to 250 mM Imidazole (step elution).

Procedure: Supernatant was loaded by gravity flow on the Ni-sepharose column. The column was then washed with 30 ml wash buffer by gravity flow. The protein was eluted by gravity flow by applying 5-ml portions of elution buffer with increasing concentration of imidazole (50 mM, 100 mM, 150 mM and 250 mM); fractions were collected until essentially all protein was eluted.

Enzymatic treatment : The N-terminal His tag was cleaved by treatment with TEV protease

Column 2: Size Exclusion Chromatography. Superdex S75 16/60 HiLoad

Buffers: 10 mM HEPES, pH 7.5; 500 mM NaCl, 5% glycerol

Procedure: EP300 was concentrated and applied to an S75 16/60 HiLoad gel filtration column equilibrated in 10 mM HEPES, pH 7.5; 500mM NaCl, 5% glycerol using an ÄKTAexpress system.

Column 3: Ni-affinity. Ni-sepharose (Amersham), 2 ml of 50% slurry in a Bio-rad poly-prep column, washed with binding buffer.

Buffers: Binding buffer: 10 mM HEPES pH 7.5, 500 mM NaCl, 5% Glycerol; Wash buffer: 10 mM HEPES pH 7.5, 500 mM NaCl, 5% Glycerol; Elution buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 250 mM Imidazole.

Procedure: Gel filtration fractions containing EP300 were pooled and loaded by gravity flow on the Ni-sepharose column. After loading a further 4 ml of binding buffer was added and the full flow through was collected. The column was then washed with 5 ml wash buffer at gravity flow. Finally, 6 ml of elution buffer was added. Flow through, wash and elution fractions were analysed by SDS PAGE. The TEV-cleaved EP300 protein was mainly found in the flow through fraction.

Mass spec characterization: LC- ESI -MS TOF gave a measured mass of 14639 for this construct as predicted from the sequence of this protein.

Protein concentration: The protein was concentrated to 9.0 mg/ml using an Amicon 3 kDa cut-off concentrator.

Crystallization: Crystals were grown at 4°C in 600 nl sitting drops from a 1:1 ratio of protein to reservoir solution containing 30% w/v PEG 3350; 0.2M ammonium sulfate; 5.5pH Bis-Tris.

Data Collection: Crystals were cryo-protected using 2M Li2SO4 and flash frozen in liquid nitrogen; X-ray source: Diffraction data were collected from a single crystal on beamline X10SA of the Swiss Light Source at a single wavelength of 1.000 Å and the structure was refined to 2.33 Å; Phasing: The structure was solved by molecular replacement using an ensemble of known bromodomain structures as a starting model.

References

Blobel, G.A. (2002). CBP and p300: versatile coregulators with important roles in hematopoietic gene expression. Journal of leukocyte biology 71, 545-556.

Chan, H.M., and La Thangue, N.B. (2001). p300/CBP proteins: HATs for transcriptional bridges and scaffolds. J Cell Sci 114, 2363-2373.

Goodman, R.H., and Smolik, S. (2000). CBP/p300 in cell growth, transformation, and development. Genes Dev 14, 1553-1577.

Kalkhoven, E. (2004). CBP and p300: HATs for different occasions. Biochem Pharmacol 68, 1145-1155.

Roelfsema, J.H., and Peters, D.J. (2007). Rubinstein-Taybi syndrome: clinical and molecular overview. Expert Rev Mol Med 9, 1-16.

Yao, T.P., Oh, S.P., Fuchs, M., Zhou, N.D., Ch'ng, L.E., Newsome, D., Bronson, R.T., Li, E., Livingston, D.M., and Eckner, R. (1998). Gene dosage-dependent embryonic development and proliferation defects in mice lacking the transcriptional integrator p300. Cell 93, 361-372.