Human pleckstrin homology domain interacting protein (2nd bromodomain)

Target ID:

PHIPA

Aliases:

FLJ20705FLJ45918MGC90216ndrpPHIPWDR11

Deposition Date:

Thursday 25th March 2010

Families:

Bromodomain

Related Diseases:

Epigenetics

Structure type:

protein-ligand

Download Coordinates:

3MB3

Authors:

Filippakopoulos, P., Keates, T., Picaud, S., Hapka, E., Vollmar, M., Chaikuad, A., Krojer, T., Canning, P., von Delft, F., Arrowsmith, C.H., Edwards, A.M., Weigelt, J., Bountra, C., Knapp, S.

Site:

Oxford

ICM Datapack:

ICM Datapack

3MB3

tabs

Structure Details

The pleckstrin homology domain interacting protein, PHIP has originally been identified as a protein interacting with the PH domain of insulin receptor substrate IRS-1 (Farhang-Fallah et al., 2000). PHIP modulates insulin induced transcriptional responses and insulin receptor-mediated signalling pathways (Farhang-Fallah et al., 2002). More recently, it has been shown that PHIP enhances proliferation of pancreatic beta cells and may therefore present an attractive target for the treatment of diabetes. Initial results point to a more general role of PHIP as a cytoprotectant, which is in accordance with the widespread expression of PHIP (Podcheko et al., 2007). In addition PHIP has been shown to interact with Cul4 E3 ubiquitin ligase and the (damage-specific DNA binding protein 1 (Ddb1) adaptor protein pointing to a potential role of PHIP in substrate recruitment for protein degradation (Jin et al., 2006).

PHIP is closely related to two other proteins, BRWD1 and BRWD3. Proteins of this family share a common domain organization which comprises a number of WD40 repeats in the N-terminus followed by two Bromodomains. The sequences in their C-termini are however quite diverse (Philipps et al., 2008). Here we report the structure of the second Bromodomain of PHIP at 2.25 Å resolution.

Materials and Methods

Materials and Method
Note: To our best knowledge, this should represent an accurate description of the materials and methods required to reproduce our work. If any of the content on this page is difficult to interpret or should you have trouble repeating our work, do not hesitate to contact us as soon as possible in order for us to provide additional information and advice.

Entry Clone Source: Synthetic

Entry Clone Accession: n/a

SGC Construct ID: PHIPA-c034

GenBank GI number: gi|34996489

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified construct sequence:
CATATGCACCATCATCATCATCATTCTTC
TGGTGTAGATCTGGGTACCGAGAACCTGT
ACTTCCAATCCATGGATCATCAGCCGCGT
CGTCGTCTGCGCAACCGTGCGCAGAGCTA
TGATATCCAGGCGTGGAAAAAACAGTGCG
AAGAACTGCTGAATCTGATTTTTCAGTGT
GAAGATAGCGAACCGTTTCGTCAGCCGGT
TGATCTGCTGGAATATCCGGATTATCGCG
ATATCATTGATACCCCGATGGATTTTGCG
ACCGTGCGCGAAACCCTGGAAGCGGGTAA
CTATGAAAGCCCGATGGAACTGTGCAAAG
ATGTGCGCCTGATTTTTAGCAACAGCAAA
GCCTATACCCCGAGCAAACGTAGCCGTAT
CTATAGCATGAGCCTGCGTCTGAGCGCGT
TTTTTGAAGAACACATTAGCAGCGTGCTG
AGCGATTATAAAAGCGCGCTGCGCTTTCA
TAAACGTTGACAGTAAAGGTGGATACGGA
TCCGAA

Tags and additions: Cleavable N-terminal His6 tag.

Final protein sequence:
MHHHHHHSSGVDLGTENLYFQ^SMDHQPR
RRLRNRAQSYDIQAWKKQCEELLNLIFQC
EDSEPFRQPVDLLEYPDYRDIIDTPMDFA
TVRETLEAGNYESPMELCKDVRLIFSNSK
AYTPSKRSRIYSMSLRLSAFFEEHISSVL
SDYKSALRFHKR

^ TEV cleave site

Host: BL21 (DE3)R3-pRARE2 (Phage resistant strain)

Growth medium, induction protocol: 10 ml from a 50 ml overnight culture containing 50 µg/ml kanamycin and 34 µg/ml chloramphenicol were used to inoculate each of two 1 liter cultures of TB containing 50 µg/ml kanamycin and 34 µg/ml chloramphenicol. Cultures were grown at 37°C until the OD₆₀₀ reached ~2.5 then the temperature was adjusted to 18°C. Expression was induced overnight using 0.1 mM IPTG at an OD₆₀₀ of 3.0. The cells were collected by centrifugation and the pellet re-suspended in binding buffer and frozen. Binding buffer: 50 mM HEPES pH 7.5; 500 mM NaCl; 10 mM imidazole, 5% glycerol.

Extraction buffer, extraction method: Frozen pellets were thawed and fresh 0.5 mM TCEP, 1 mM PMSF added to the lysate. Cells were lysed using sonication. The lysate was centrifuged at 17,000 rpm for 60 minutes and the supernatant collected for purification.

Column 1: Ni-affinity. Ni-sepharose (Amersham), 5 ml of 50% slurry in 1.5 x 10 cm column, washed with binding buffer.

Buffers: Binding buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 5 mM imidazole, 5% glycerol; Wash buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 30 mM Imidazole, 5% glycerol; Elution buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 5% glycerol, 50 to 250 mM Imidazole (step elution).

Procedure: The supernatant was loaded by gravity flow on the Ni-sepharose column. The column was then washed with 30 ml wash buffer at gravity flow. The protein was eluted by gravity flow by applying 5-ml portions of elution buffer with increasing concentration of imidazole (50 mM, 100 mM, 150 mM, 200 and 250 mM); fractions were collected until essentially all protein was eluted.

Enzymatic treatment: The N-terminal His tag was cleaved by treatment with TEV protease, overnight.

Column 2: Size Exclusion Chromatography. Superdex S75 16/60 HiLoad.

Buffers: 10 mM HEPES, pH 7.5; 500 mM NaCl, 5% glycerol.

Procedure: The protein was concentrated and applied to an S75 16/60 HiLoad gel filtration column equilibrated in 10 mM HEPES, pH 7.5; 500mM NaCl, 5% glycerol using an ÄKTAexpress system.

Mass spec characterization: LC- ESI -MS TOF gave a measured mass of 1607 for this construct as predicted from the sequence of this protein.

Protein concentration: Protein was concentrated to 18.6 mg/ml using an Amicon 3 kDa cut-off concentrator.

Crystallization: Crystals were grown at 4°C in 300 nl sitting drops from a 1:2 ratio of protein to reservoir solution containing 11% PEG 3350, 4 % glycerol, 0.1 M acetate pH 4.6. 2mM NMP was added to the protein solution.

Data Collection: Crystals were cryo-protected using the well solution supplemented by 30% glycerol and flash frozen in liquid nitrogen.
X-ray source: Diffraction data were collected from a single crystal on Diamond beamline I04 at a single wavelength of 0.9762 Å and the structure was refined to 2.25 Å.
Phasing: The structure was solved by molecular replacement using an ensemble of known bromodomain structures as a starting model.

References

Farhang-Fallah, J., Randhawa, V.K., Nimnual, A., Klip, A., Bar-Sagi, D., and Rozakis-Adcock, M. (2002). The pleckstrin homology (PH) domain-interacting protein couples the insulin receptor substrate 1 PH domain to insulin signaling pathways leading to mitogenesis and GLUT4 translocation. Mol Cell Biol 22, 7325-7336.

Farhang-Fallah, J., Yin, X., Trentin, G., Cheng, A.M., and Rozakis-Adcock, M. (2000). Cloning and characterization of PHIP, a novel insulin receptor substrate-1 pleckstrin homology domain interacting protein. J Biol Chem 275, 40492-40497.

Jin, J., Arias, E.E., Chen, J., Harper, J.W., and Walter, J.C. (2006). A family of diverse Cul4-Ddb1-interacting proteins includes Cdt2, which is required for S phase destruction of the replication factor Cdt1. Mol Cell 23, 709-721.

Philipps, D.L., Wigglesworth, K., Hartford, S.A., Sun, F., Pattabiraman, S., Schimenti, K., Handel, M., Eppig, J.J., and Schimenti, J.C. (2008). The dual bromodomain and WD repeat-containing mouse protein BRWD1 is required for normal spermiogenesis and the oocyte-embryo transition. Dev Biol 317, 72-82.

Podcheko, A., Northcott, P., Bikopoulos, G., Lee, A., Bommareddi, S.R., Kushner, J.A., Farhang-Fallah, J., and Rozakis-Adcock, M. (2007). Identification of a WD40 repeat-containing isoform of PHIP as a novel regulator of beta-cell growth and survival. Mol Cell Biol 27, 6484-6496.