Human CECR2 (Bromodomain)

Target ID:

CECR2A

Aliases:

CECR2KIAA1740

Deposition Date:

Tuesday 13th July 2010

Families:

Bromodomain

Related Diseases:

Epigenetics

Structure type:

apo

Download Coordinates:

3NXB

Authors:

Filippakopoulos, P., Picaud, S., Keates, T., Muniz, J., Von Delft, F., Arrowsmith, C.H., Edwards, A., Weigelt, J., Bountra, C., Knapp, S.

Site:

Oxford

3NXB

tabs

Structure Details

CECR2 has been identified as one of the genes located in the cat eye syndrome critical region of chromosome 22. CAT eye syndrome is a developmental disorder characterised by a variety of congenital defects including ocular coloboma, anal atresia, preauricular tags/pits, heart and kidney defects, dysmorphic facial features, and variable defects in mental development (Footz et al., 2001). CECR2 is widely expressed and shows high expression in the neural tube of the developing embryo. The protein contains an AT hook motif, a DNA-binding motif with a preference for A/T rich regions, as well as a bromodomain (Banting et al., 2005). The protein is located in the nucleus, where it has been found to interact with a number of proteins involved in transcriptional regulation (Liu and McKeehan, 2002), (Banting et al., 2005). CECR2 forms a complex with SNF2L, a mammalian ISWI ortholog, which has been shown to remodel chromatin in an ATP-dependent manner (Banting et al., 2005).

In a genetrap-induced mouse model, in which a homozygous mutation for Cecr2 has been introduced, a function for Cecr2 in neurulation has been demonstrated. Most mice die perinatally and show a high penetrance of neural tube defect exencephaly in a female dominant manner. Also in chicken embryos expression of Cecr2 is predominantly in neural tissue undermining the role of this protein in neurulation (Banting et al., 2005) (Chen et al., 2010). Here we present the structure of the CECR2 Bromo domain at 1.8 Å resolution.

Materials and Methods

GI number: gi|148612882

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified construct sequence:
CATATGCACCATCATCATCATCATTCTTCT
GGTGTAGATCTGGGTACCGAGAACCTGTAC
TTCCAATCCATGCGTGAAGAAAAAAAAACC
AAAGATCTGTTTGAACTGGATGATGATTTT
ACCGCCATGTATAAAGTGCTGGATGTGGTG
AAAGCCCACAAAGATAGCTGGCCGTTTCTG
GAACCGGTGGATGAAAGCTATGCGCCGAAT
TATTATCAGATCATTAAAGCGCCGATGGAT
ATTAGCAGCATGGAAAAAAAACTGAATGGT
GGCCTGTATTGCACCAAAGAAGAATTTGTG
AACGATATGAAAACCATGTTTCGTAACTGC
CGTAAATATAATGGTGAAAGCAGCGAATAT
ACCAAAATGAGCGATAACCTGGAACGTTGC
TTTCATCGTGCGATGATGAAACATTGACAG
TAAAGGTGGATACGGATCCGAA

Final protein sequence:
mhhhhhhssgvdlgtenlyfq^SMREEKKTKDLF
ELDDDFTAMYKVLDVVKAHKDSWPF
LEPVDESYAPNYYQIIKAPMDISSMEK
KLNGGLYCTKEEFVNDMKTMFRNCR
KYNGESSEYTKMSDNLERCFHRAMM
KH

^ TEV cleave site

Tags and additions: Cleavable N-terminal His6 tag.

Host: BL21 (DE3)R3-pRARE2 (Phage resistant strain).

Growth medium, induction protocol: 10ml from a 50ml overnight culture containing 50µg/ml kanamycin and 34µg/ml chloramphenicol were used to inoculate each of two 1 liter cultures of TB containing 50µg/ml kanamycin and 34µg/ml chloramphenicol. Cultures were grown at 37°C until the OD₆₀₀ reached ~2.5 then the temperature was adjusted to 1°C. Expression was induced overnight using 0.1 mM IPTG at an OD₆₀₀ of 3.0. The cells were collected by centrifugation and the pellet re-suspended in binding buffer and frozen.
Binding buffer: 50 mM HEPES pH 7.5; 500 mM NaCl; 10 mM imidazole, 5% glycerol.
Extraction buffer, extraction method: Frozen pellets were thawed and fresh 0.5 µM TCEP, 1 mM PMSF added to the lysate. Cells were lysed using a French press. The lysate was centrifuged at 17,000 rpm for 60 minutes and the supernatant was collected for purification.

Column 1: Ni-affinity. Ni-sepharose (Amersham), 5 ml of 50% slurry in 1.5 x 10 cm column, washed with binding buffer.

Column 1 Buffers:
Binding buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 5 mM imidazole, 5% glycerol.
Wash buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 30 mM Imidazole, 5% glycerol.
Elution buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 5% glycerol, 50 to 250 mM Imidazole (step elution).

Column 1 Procedure: The supernatant was loaded by gravity flow on the Ni-sepharose column. The column was then washed with 30ml wash buffer at gravity flow. The protein was eluted by gravity flow by applying 5ml portions of elution buffer with increasing concentration of imidazole (50 mM, 100 mM, 150 mM, 200 mM and 250 mM); fractions were collected until essentially all protein was eluted.

Enzymatic treatment: The N-terminal His tag was cleaved by treatment with TEV protease, overnight.

Column 2: Size Exclusion Chromatography. Superdex S75 16/60 HiLoad.

Column 2 Buffer: 10 mM HEPES, pH 7.5; 500 mM NaCl, 5% glycerol.

Column 2 Procedure: The protein was concentrated and applied to an S75 16/60 HiLoad gel filtration column equilibrated in 10 mM HEPES, pH 7.5; 500mM NaCl, 5 % glycerol using an ÄKTAexpress system.

Mass spectrometry characterization: LC- ESI -MS TOF gave a measured mass of 13834 for this construct as predicted from the sequence of this protein.

Protein concentration: Protein was concentrated to 10.4 mg/ml using an Amicon 3 kDa cut-off concentrator.

Crystallisation: NMP was added to the protein solution to a final concentration of 2 mM prior to crystallization. Crystals were grown at 4°C in 300 nl sitting drops from a 2:1 ratio of protein to reservoir solution containing 0.1 M MES pH 6.5 and 12% PEG 20,000.

Data Collection: Crystals were cryo-protected using the well solution supplemented by 30% sucrose and 20% ethylene glycol and flash frozen in liquid nitrogen.
X-ray source: Diffraction data were collected from a single crystal on a Rigaku FRE Superbright at a single wavelength of 1.5 Å and the structure was refined to 1.83 Å.
Phasing: The structure was solved by molecular replacement using an ensemble of known bromodomain structures as a starting model.

References

Banting, G.S., Barak, O., Ames, T.M., Burnham, A.C., Kardel, M.D., Cooch, N.S., Davidson, C.E., Godbout, R., McDermid, H.E., and Shiekhattar, R. (2005). CECR2, a protein involved in neurulation, forms a novel chromatin remodeling complex with SNF2L. Hum Mol Genet 14, 513-524.
Chen, J., Morosan-Puopolo, G., Dai, F., Wang, J., and Brand-Saberi, B. (2010). Molecular cloning of chicken Cecr2 and its expression during chicken embryo development. Int J Dev Biol 54, 925-929.
Footz, T.K., Brinkman-Mills, P., Banting, G.S., Maier, S.A., Riazi, M.A., Bridgland, L., Hu, S., Birren, B., Minoshima, S., Shimizu, N., et al. (2001). Analysis of the cat eye syndrome critical region in humans and the region of conserved synteny in mice: a search for candidate genes at or near the human chromosome 22 pericentromere. Genome Res 11, 1053-1070.
Liu, L., and McKeehan, W.L. (2002). Sequence analysis of LRPPRC and its SEC1 domain interaction partners suggests roles in cytoskeletal organization, vesicular trafficking, nucleocytosolic shuttling, and chromosome activity. Genomics 79, 124-136.