Human protein kinase Myt1

Target ID:

PKMYT1A

Aliases:

DKFZp547K1610FLJ20093MYT1PKMYT1

Deposition Date:

Thursday 30th September 2010

Families:

Protein Kinase

Related Diseases:

Cancer

Structure type:

protein-ligand

Download Coordinates:

3P1A

Authors:

Chaikuad, A., Eswaran, J., Fedorov, O., Cooper, C., Kroeler, T., Vollmar, M., Krojer, T., Berridge, G., Muniz, J.R.C., Pike, A.C.W., von Delft, F., Weigelt, J., Arrowsmith, C.H., Edwards, A.M., Bountra, C., Knapp, S.

Site:

Oxford

3P1A

tabs

Structure Details

PKMYT1 (also known as Myt1) belongs to the WEE1-like subfamily family of kinases. In metazoans two different kinases are present: the nuclear protein WEE1 and the cytoplasmic membrane-bound MYT1 kinase, whereas in yeast only one Wee kinase exists. WEE-like kinases phosphorylate and regulate the cell division control protein CDC2 thereby controlling progress through the cell cycle at the G2/M transition (Fattaey and Booher, 1997), (Booher et al., 1997).

PKMYT1 is a dual specificity kinase, which phosphorylates CDC2 on Thr14 and Tyr15 negatively regulating CDC2-Cyclin B complexes and causing G2/M arrest in the case of DNA damage (Nakajima et al., 2003), (Liu et al., 1999). PKMYT1 in turn is regulated by multiple kinases including p90RSK and Akt as well as Plk during M phase in somatic cell cycles (Nakajima et al., 2003). PKMYT localizes to the endoplasmic reticulum and golgi complex throughout interphase and has been suggested to be essential for golgi and ER assembly at the end of mitosis (Nakajima et al., 2008). No mouse model for PKMYT1 has been published yet but ectopic expression of MYT1 in Drosophila suggests this kinase to be involved in eye development (Price et al., 2002).

PKMYT1 associates with JNK1 upon UVA treatment of skin carcinoma cells activating apoptosis, which may have implication for skin cancer treatment (Choi et al., 2009). It has also been identified as potential biomarker for metastatic clear-cell renal-cell carcinoma (Tan et al., 2008). In addition, PKMYT1 is overexpressed in TPA induced reactivation of latent infections of Kaposi's sarcoma-associated herpesvirus. This prolongs the S and G2 phases of the cell cycle, allowing additional time for the lytic replication of the virus (Bryan et al., 2006).

Interestingly, PKMYT1 has been identified as one of the genes differentially expressed in fetal and adult brain of Klinefelter syndrome individuals, correlated with verbal cognitive functioning but the significance of this finding needs to be demonstrated (Vawter et al., 2007). Here we present the structure of the PKMYT1 kinase domain at 1,9 Å resolution.

Materials and Methods

Entry Clone Source: Synthetic

Entry Clone Accession: n/a

SGC Construct ID: PKMYT1A-c004

GenBank GI number: gi|33383241

GI number: gi|33383241

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified construct sequence:
CATATGCACCATCATCATCATCATTCTTCT
GGTGTAGATCTGGGTACCGAGAACCTGTAC
TTCCAATCCATGCACCAGTTGCAACCTCGT
CGTGTTTCTTTTCGCGGCGAGGCTTCAGAA
ACCTTGCAGAGCCCAGGTTATGATCCGTCC
CGCCCAGAAAGTTTCTTTCAACAGTCGTTC
CAACGCCTCAGCCGTCTGGGACATGGTTCT
TACGGCGAAGTATTCAAAGTACGCTCCAAA
GAGGACGGCCGTTTGTATGCGGTGAAACGC
TCAATGAGTCCGTTTCGTGGCCCCAAAGAT
CGCGCCCGTAAGCTGGCGGAAGTTGGCTCT
CACGAGAAAGTCGGCCAGCATCCGTGTTGC
GTACGCCTGGAGCAAGCCTGGGAAGAAGGC
GGTATTCTGTACCTGCAGACAGAGCTGTGC
GGCCCTTCACTGCAACAGCACTGTGAGGCG
TGGGGTGCAAGTTTGCCAGAAGCTCAAGTG
TGGGGTTATCTGCGTGACACCTTGCTGGCC
TTGGCACATCTGCATTCGCAGGGTTTGGTT
CACCTGGATGTCAAGCCCGCCAACATCTTC
CTGGGCCCTCGTGGTCGTTGTAAACTGGGC
GATTTTGGCCTGTTGGTGGAGTTGGGCACT
GCGGGTGCTGGTGAAGTACAAGAAGGCGAT
CCGCGTTACATGGCACCAGAATTGCTGCAG
GGCTCTTATGGTACAGCCGCGGATGTTTTC
AGCCTGGGCTTGACTATTCTGGAGGTAGCT
TGCAATATGGAGCTGCCCCACGGCGGCGAA
GGTTGGCAACAGTTGCGCCAAGGTTACCTG
CCCCCTGAGTTTACCGCCGGTTTGTCATCC
GAGTTGCGCAGTGTACTGGTCATGATGCTG
GAGCCCGATCCGAAACTGCGCGCAACAGCT
GAAGCATTGCTGGCTTTGCCCGTTTTGCGC
CAACCATGACAGTAAAGGTGGATACGGATC
CGAA

Final protein sequence (tag sequence in lowercase):
mhhhhhhssgvdlgtenlyfq^smHQLQPRRVSFR
GEASETLQSPGYDPSRPESFFQQSFQRL
SRLGHGSYGEVFKVRSKEDGRLYAVK
RSMSPFRGPKDRARKLAEVGSHEKVG
QHPCCVRLEQAWEEGGILYLQTELCGP
SLQQHCEAWGASLPEAQVWGYLRDTL
LALAHLHSQGLVHLDVKPANIFLGPRG
RCKLGDFGLLVELGTAGAGEVQEGDPR
YMAPELLQGSYGTAADVFSLGLTILEVA
CNMELPHGGEGWQQLRQGYLPPEFTA
GLSSELRSVLVMMLEPDPKLRATAEAL
LALPVLRQP

^ TEV cleave site

Tags and additions: Cleavable N-terminal His6 tag.

Host: BL21 (DE3)R3-pRARE2 (Phage resistant strain)

Growth medium, induction protocol: 5ml from a 50ml overnight culture containing 50µg/ml kanamycin & 34µg/ml chloramphenicol were used to inoculate each of two 1 litre cultures of LB containing 50µg/ml kanamycin & 34µg/ml chloramphenicol. Cultures were grown at 37°C until the OD₆₀₀ reached ~0.5 then the temperature was adjusted to 18°C. Expression was induced overnight using 0.5 mM IPTG at an OD₆₀₀ of 0.9. The cells were collected by centrifugation and the pellet re-suspended in binding buffer and frozen.
Binding buffer: 50 mM HEPES pH 7.5; 500 mM NaCl; 5 mM imidazole, 5 % glycerol.
Extraction buffer, extraction method: Frozen pellets were thawed and fresh 0.5 mM TCEP added to the lysate. Cells were lysed using C5 high pressure homogenizer (Avestin). The lysate was centrifuged at 16,500 rpm for 60 minutes and the supernatant collected for purification.

Column 1: Ni-affinity. Ni-Sepharose (Amersham), 5 ml of 50 % slurry in 1.5 x 10 cm column, washed with binding buffer.

Column 1 Buffers:
Binding buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 5 mM imidazole, 5% Glycerol.
Wash buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 25 mM Imidazole, 5% glycerol.
Elution buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 50 to 250 mM Imidazole, 5% Glycerol (step elution).

Column 1 Procedure: The lysate supernatant was loaded by gravity flow on the Ni-sepharose column. The column was then washed with 30 ml wash buffer at gravity flow. The protein was eluted by gravity flow by applying 5-ml portions of elution buffer with increasing concentration of imidazole (50mM, 100mM, 150mM and 250mM); fractions were collected until essentially all protein was eluted.

Column 2: Size Exclusion Chromatography. Superdex S200 16/60 HiLoad

Column 2 Buffer: 25 mM HEPES, pH 7.5; 500 mM NaCl, 0.5 mM TCEP

Column 2 Procedure: The protein was concentrated and applied to an S200 16/60 HiLoad gel filtration column equilibrated in 25 mM HEPES, pH 7.5; 500 mM NaCl, 0.5 mM TCEP using an ÄKTA express system.

Mass spectrometry characterization : LC- ESI -MS TOF revealed that the recombinant protein had a mass of 34535 correlating well with the estimated mass of 34453.2 plus 1 phosphorylation site.

Protein concentration: Protein was concentrated to 12 mg/ml using an Amicon 10 kDa cut-off concentrator.

Crystallisation: Crystals in complex with K00032 ("Calbiochem (EMD) #266788") were grown at 4°C in 300 nl sitting drops from a 1:2 ratio of reservoir solution ("0.20M Na2SO4; 0.1M BTProp pH 6.5; 20.0% PEG 3350; 10.0% EtGly") and protein.

Data Collection: Crystals were cryo-protected using the well solution supplemented with 22 % Ethylene glycol and flash frozen in liquid nitrogen.
X-ray source: Diffraction data were collected from a single crystal for each dataset on Diamond beamline IO4 at a single wavelength.

References

Booher, R.N., Holman, P.S., and Fattaey, A. (1997). Human Myt1 is a cell cycle-regulated kinase that inhibits Cdc2 but not Cdk2 activity. J Biol Chem 272, 22300-22306.
Bryan, B.A., Dyson, O.F., and Akula, S.M. (2006). Identifying cellular genes crucial for the reactivation of Kaposi's sarcoma-associated herpesvirus latency. J Gen Virol 87, 519-529.
Choi, H.S., Bode, A.M., Shim, J.H., Lee, S.Y., and Dong, Z. (2009). c-Jun N-terminal kinase 1 phosphorylates Myt1 to prevent UVA-induced skin cancer. Mol Cell Biol 29, 2168-2180.
Choi, H.S., Bode, A.M., Shim, J.H., Lee, S.Y., and Dong, Z. (2009). c-Jun N-terminal kinase 1 phosphorylates Myt1 to prevent UVA-induced skin cancer. Mol Cell Biol 29, 2168-2180.
Liu, F., Rothblum-Oviatt, C., Ryan, C.E., and Piwnica-Worms, H. (1999). Overproduction of human Myt1 kinase induces a G2 cell cycle delay by interfering with the intracellular trafficking of Cdc2-cyclin B1 complexes. Mol Cell Biol 19, 5113-5123.
Nakajima, H., Toyoshima-Morimoto, F., Taniguchi, E., and Nishida, E. (2003). Identification of a consensus motif for Plk (Polo-like kinase) phosphorylation reveals Myt1 as a Plk1 substrate. J Biol Chem 278, 25277-25280.
Nakajima, H., Yonemura, S., Murata, M., Nakamura, N., Piwnica-Worms, H., and Nishida, E. (2008). Myt1 protein kinase is essential for Golgi and ER assembly during mitotic exit. J Cell Biol 181, 89-103.
Price, D.M., Jin, Z., Rabinovitch, S., and Campbell, S.D. (2002). Ectopic expression of the Drosophila Cdk1 inhibitory kinases, Wee1 and Myt1, interferes with the second mitotic wave and disrupts pattern formation during eye development. Genetics 161, 721-731.
Tan, X., Zhai, Y., Chang, W., Hou, J., He, S., Lin, L., Yu, Y., Xu, D., Xiao, J., Ma, L., et al. (2008). Global analysis of metastasis-associated gene expression in primary cultures from clinical specimens of clear-cell renal-cell carcinoma. Int J Cancer 123, 1080-1088.
Vawter, M.P., Harvey, P.D., and DeLisi, L.E. (2007). Dysregulation of X-linked gene expression in Klinefelter's syndrome and association with verbal cognition. Am J Med Genet B Neuropsychiatr Genet 144B, 728-734.