Human Cbl-b TKB domain in complex with EGFR pY1069 peptide

Target ID:

CBLBA

Aliases:

CBLBDKFZp686J10223DKFZp779A0729DKFZp779F1443FLJ36865FLJ41152Nbla00127RNF56

Deposition Date:

Friday 29th October 2010

Families:

Signalling proteinsUbiquitin Related BiologyUbiquitylation - E3 Ligases

Structure type:

protein-ligand

Download Coordinates:

3PFV

Authors:

Chaikuad, A., Guo, K., Cooper, C.D.O., Ayinampudi, V., Krojer, T., Muniz, J.R.C., Vollmar, M., Canning, P., Gileadi, O., von Delft, F., Arrowsmith, C.H., Weigelt, J., Edwards, A.M., Bountra, C., Bullock, A.

Site:

Oxford

3PFV

tabs

Structure Details

The Cbl (for Casitas B-lineage lymphoma) family of E3 ubiquitin ligases comprises the three members Cbl, Cbl-b and Cbl-c. The founding member Cbl was discovered first as the oncogenic protein v-Cbl, a Gag-fusion transforming protein of Cas NS-1 retrovirus, which causes pre- and pro-B lymphomas in mice. Both Cbl (or c-Cbl) and Cbl-b are widely expressed and share a common protein as well as gene structure, whereas Cbl-c shows only sequence identity to the amino-terminal sequences of Cbl and Cbl-b, but lacks the leucine zipper motif and most of the proline-rich domain in the C-terminus. The N-terminus of the Cbl proteins is composed of a tyrosine kinase-binding (TKB) domain, also called phosphotyrosine binding (PTB) domain, a short linker region and the RING-type zinc finger. The TKB domain mediates interaction with other proteins and consists of a four-helix bundle (4H), a calcium-binding EF hand and a divergent SH2 domain (Swaminathan and Tsygankov, 2006), (Loeser and Penninger, 2007b).

Cbl-b plays a role in early hematopoietic development and is a negative regulator of T-cell receptor, B-cell receptor and high affinity immunoglobulin epsilon receptor signal transduction pathways (Loeser and Penninger, 2007a), (Qu et al., 2004), (Huang and Gu, 2008). Accordingly, knockout mice lacking Cbl-b show enhanced T-cell activation with hyperresponsiveness to T-cell receptor stimulation. Loss of Cbl-b in mice also uncouples T-cell activation from CD28 co-stimulation and makes these mice more susceptible to spontaneous and peptide induced activation pointing to a role of Cbl-b in promoting anergy, which prevents T-cells to react against self-antigens autoimmunity (Loeser and Penninger, 2007a), (Rudd and Schneider, 2000), (Mueller, 2004). Cbl-b thereby maintains the balance between tolerance, activation, and autoimmunity.

Outside the immune system Cbl-b negatively regulates insulin-like growth factor 1 signaling during muscle atrophy caused by unloading and is also involved in EGFR ubiquitination and internalization (Nakao et al., 2009), (Pennock and Wang, 2008).

Defects of Cbl-b are associated with a variety of human diseases. A genome wide association study has found variants of Cbl-b to be associated with multiple sclerosis and impairment of the Cbl-b signaling pathway is thought to contribute to human autoimmune diseases, including type 1 diabetes (Sanna et al., 2010), (Bergholdt et al., 2005). Loss of Cbl-b may be responsible for the craniofacial phenotype in patients with deletions of the proximal 3q region, a phenotype that is also found in the Cbl-b knockout mouse due to enhanced osteoclastogenesis in the bones of the skull (Simovich et al., 2008).

Here we report the crystal structure of the TKB domain of Cbl-b in complex with EGFR pY1069 peptide refined at 2.3 Å resolution.

Materials and Methods

Entry Clone Source: MGC

Entry Clone Accession: IMAGE:5269036

SGC Construct ID: CBLBA-c024

GenBank GI number: gi|54112420

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified construct sequence:
TTAAGAAGGAGATATACTATGCAAGC
TGCCGCAGATCGCAGGACCGTGGAGA
AGACTTGGAAGCTCATGGACAAAGTG
GTAAGACTGTGCCAAAATCCCAAACT
TCAGTTGAAAAATAGCCCACCATATA
TACTTGATATTTTGCCTGATACATAT
CAGCATTTACGACTTATATTGAGTAA
ATATGATGACAACCAGAAACTTGCCC
AACTCAGTGAGAATGAGTACTTTAAA
ATCTACATTGATAGCCTTATGAAAAA
GTCAAAACGGGCAATAAGACTCTTTA
AAGAAGGCAAGGAGAGAATGTATGAA
GAACAGTCACAGGACAGACGAAATCT
CACAAAACTGTCCCTTATCTTCAGTC
ACATGCTGGCAGAAATCAAAGCAATC
TTTCCCAATGGTCAATTCCAGGGAGA
TAACTTTCGTATCACAAAAGCAGATG
CTGCTGAATTCTGGAGAAAGTTTTTT
GGAGACAAAACTATCGTACCATGGAA
AGTATTCAGACAGTGCCTTCATGAGG
TCCACCAGATTAGCTCTGGCCTGGAA
GCAATGGCTCTAAAATCAACAATTGA
TTTAACTTGCAATGATTACATTTCAG
TTTTTGAATTTGATATTTTTACCAGG
CTGTTTCAGCCTTGGGGCTCTATTTT
GCGGAATTGGAATTTCTTAGCTGTGA
CACATCCAGGTTACATGGCATTTCTC
ACATATGATGAAGTTAAAGCACGACT
ACAGAAATATAGCACCAAACCCGGAA
GCTATATTTTCCGGTTAAGTTGCACT
CGATTGGGACAGTGGGCCATTGGCTA
TGTGACTGGGGATGGGAATATCTTAC
AGACCATACCTCATAACAAGCCCTTA
TTTCAAGCCCTGATTGATGGCAGCAG
GGAAGGATTTTATCTTTATCCTGATG
GGAGGAGTTATAATCCTGATTTAACT
GGATTAGCAGAGAACCTCTACTTCCA
ATC

Final protein sequence (Tag sequence in lowercase):
MQAAADRRTVEKTWKLMDKVVRLCQN
PKLQLKNSPPYILDILPDTYQHLRLI
LSKYDDNQKLAQLSENEYFKIYIDSL
MKKSKRAIRLFKEGKERMYEEQSQDR
RNLTKLSLIFSHMLAEIKAIFPNGQF
QGDNFRITKADAAEFWRKFFGDKTIV
PWKVFRQCLHEVHQISSGLEAMALKS
TIDLTCNDYISVFEFDIFTRLFQPWG
SILRNWNFLAVTHPGYMAFLTYDEVK
ARLQKYSTKPGSYIFRLSCTRLGQWA
IGYVTGDGNILQTIPHNKPLFQALID
GSREGFYLYPDGRSYNPDLTGLAENL
YFq^shhhhhhdykddddk

^ TEV cleave site

Tags and additions: TEV-cleavable C-terminal His tag.

Host: BL21 (DE3)R3-pRARE2.

Growth medium, induction protocol: A glycerol stock was used to inoculate a 10ml starter culture containing LB media with 50µg/ml Kanamycin and 34 µg/ml chloramphenicol. The starter culture was grown overnight and subsequently used to inoculate flasks containing 1L LB with 50µg/ml of kanamycin and 34µg/ml of chloramphenicol (total 6L). The cells were cultured at 37°C until the OD reached 0.620 at which point the temperature was decreased to 18°C. IPTG was added at 0.2mM (final concentration) and the culture kept at 18°C for overnight protein expression.
Extraction buffer: 500 mM NaCl, 5% Glycerol, 50 mM HEPES pH 7.5, 5 mM Imidazole. Complete Protease Inhibitor Cocktail Tablets (Roche) were added (one tablet/50ml buffer).
Extraction method: The cells were harvested by centrifugation at 4,000 g for 10 min. The pellet from 1 L culture was resuspended in 25 ml of extraction buffer. The sample was lysed using an ultrasonic processor and then centrifuged at 37505 g for 30 minutes. The supernatant was kept for further purification.

Column 1: Ni-sepharose (Amersham), 6mil of 50% slurry in 1.5 x 10cm column, washed with binding buffer.

Column 1 Buffer:
Binding buffer: 500 mM NaCl, 5% Glycerol, 50 mM HEPES pH 7.5, 5 mM Imidazole.
Elution Buffer I: 500 mM NaCl, 5% Glycerol, 50 mM HEPES pH 7.5, 30 mM Imidazole.
Elution Buffer II: 500 mM NaCl, 5% Glycerol, 50 mM HEPES pH 7.5, 60 mM Imidazole.
Elution Buffer III: 500 mM NaCl, 5% Glycerol, 50 mM HEPES pH 7.5, 250 mM Imidazole.

Column 1 Procedure: The sample was divided into two and applied by gravity flow onto two Ni-sepharose columns. The column was washed with 20 ml of binding buffer. The protein was then eluted with 5 ml of elution buffer I, II & 6 ml of elution buffer III respectively.

Enzymatic treatment: 600µl of TEV protease (6mg/ml) were added into the sample from Ni-sepharose purification (elutions I, II and III). The sample was incubalted at 4°C overnight.

Column 2: Superdex 200 Hiload 16 60

Column 2 Buffers: 500 mM NaCl, 5% Glycerol, 50 mM HEPES pH 7.5, 0.5 mM TCEP.

Column 2 Procedure: The TEV-cleaved sample was concentrated to 3ml and injected onto an S200 gel filtration column ran at 4°C on an ÄKTA Purifier. Elution fractions were analyzed by SDS-PAGE. The purest fractions were pooled.

Column 3: Ni-sepharose

Column 3 Buffer: 500 mM NaCl, 5% Glycerol, 50 mM HEPES pH 7.5, 0.5 mM TCEP.

Column 3 Procedure: The sample was loaded onto the column (packed from 1ml of Ni-NTA slurry). The flow through was collected and the column was then washed with 5ml of binding buffer (also collected).

Protein concentration: Sample from Column 3 was concentrated to 9mg/ml using a Centricon (30 kDa cut off). The final buffer contained 50 mM HEPES pH 7.5, 500 mM NaCl, 10 mM DTT.

Mass spectrometry characterization: The purified native protein was homogeneous and had an experimental mass of 36884.7 Da (expected MW = 36882.5 Da). Masses were determined by LC-MS, using an Agilent LC/MSD TOF system with reversed-phase HPLC coupled to electrospray ionisation and an orthogonal time-of-flight mass analyser. Proteins were desalted prior to mass spectrometry by rapid elution of a C3 column with a gradient of 5-95% isopropanol in water with 0.1% formic acid.

Crystallisation: Crystals were obtained at 20°C in 150nl sitting drops containing 100nl protein (9.0mg/ml CBLB protein with 1mM of EGFR p Y1069 piptide) and 50nl of reservoir solution containing 0.30 M ammonium sulphate, 0.1 M Bis-Tris pH 6.5 and 30% (v/v) PEG3350. Crystals were vitrified in well solution supplemented with 22.5% ethylene glycol

Data Collection:
Resolution: The native crystal diffracted to a resolution of 2.27 Å
X-ray source: Diamond Light Source beamline I03

References

Bergholdt, R., Taxvig, C., Eising, S., Nerup, J., and Pociot, F. (2005). CBLB variants in type 1 diabetes and their genetic interaction with CTLA4. J Leukoc Biol 77, 579-585.
Huang, F., and Gu, H. (2008). Negative regulation of lymphocyte development and function by the Cbl family of proteins. Immunol Rev 224, 229-238.
Loeser, S., and Penninger, J.M. (2007a). Regulation of peripheral T cell tolerance by the E3 ubiquitin ligase Cbl-b. Semin Immunol 19, 206-214.
Loeser, S., and Penninger, J.M. (2007b). The ubiquitin E3 ligase Cbl-b in T cells tolerance and tumor immunity. Cell Cycle 6, 2478-2485.
Mueller, D.L. (2004). E3 ubiquitin ligases as T cell anergy factors. Nat Immunol 5, 883-890.
Nakao, R., Hirasaka, K., Goto, J., Ishidoh, K., Yamada, C., Ohno, A., Okumura, Y., Nonaka, I., Yasutomo, K., Baldwin, K.M., et al. (2009). Ubiquitin ligase Cbl-b is a negative regulator for insulin-like growth factor 1 signaling during muscle atrophy caused by unloading. Mol Cell Biol 29, 4798-4811.
Pennock, S., and Wang, Z. (2008). A tale of two Cbls: interplay of c-Cbl and Cbl-b in epidermal growth factor receptor downregulation. Mol Cell Biol 28, 3020-3037.
Qu, X., Sada, K., Kyo, S., Maeno, K., Miah, S.M., and Yamamura, H. (2004). Negative regulation of FcepsilonRI-mediated mast cell activation by a ubiquitin-protein ligase Cbl-b. Blood 103, 1779-1786.
Rudd, C.E., and Schneider, H. (2000). Lymphocyte signaling: Cbl sets the threshold for autoimmunity. Curr Biol 10, R344-347.
Sanna, S., Pitzalis, M., Zoledziewska, M., Zara, I., Sidore, C., Murru, R., Whalen, M.B., Busonero, F., Maschio, A., Costa, G., et al. (2010). Variants within the immunoregulatory CBLB gene are associated with multiple sclerosis. Nat Genet 42, 495-497.
Simovich, M.J., Bland, S.D., Peiffer, D.A., Gunderson, K.L., Cheung, S.W., Yatsenko, S.A., and Shinawi, M. (2008). Delineation of the proximal 3q microdeletion syndrome. Am J Med Genet A 146A, 1729-1735.
Swaminathan, G., and Tsygankov, A.Y. (2006). The Cbl family proteins: ring leaders in regulation of cell signaling. J Cell Physiol 209, 21-43.