Human HSP90-beta (middle domain)

Target ID:

HSP90B1A

Aliases:

ECGPGP96GRP94HSP90B1TRA1

Deposition Date:

Tuesday 30th November 2010

Families:

Miscellaneous

Structure type:

apo

Download Coordinates:

3PRY

Authors:

Chaikuad, A., Pilka, E., Sharpe, T.D., Cooper, C.D.O., Phillips, C., Berridge, G., Ayinampudi, V., Fedorov, O., Keates, T., Thangaratnarajah, C., Zimmermann, T., Vollmar, M., Yue, W.W., Che, K.H., Krojer , T., Muniz, J. R.C., von Delft, F., Bountra, C., Arrowsmith, C.H., Weigelt, J., Edwards, A., Bullock, A.,

Site:

Oxford

ICM Datapack:

ICM Datapack

3PRY

tabs

Structure Details

Hsp90β (also known as Hsp84, HSP90AB1, HSPC2 or HSPCB) belongs to the Hsp90 chaperone family found ubiquitously in both pro and eukaryotes. Hsp90 proteins are not involved in de-novo folding, but instead aid in the transition of ?clients? from an inactive to active state driven by the binding and hydrolysis of ATP and aided by the association of numerous co-chaperone proteins.

The clients of Hsp90β vary greatly from steroid hormone receptors, including oestrogen and progesterone receptors, through to many protein kinases and transcription factors including pp60vsrc, p53, ASK1, Akt/PKB, eNOS, Bcl-xL and Apaf-1.

Hsp90β exists as a homodimer in solution and contains three structural domains. The N-terminal domain adopts a Bergerat ATP-binding fold and slowly hydrolyses ATP. This hydrolysis depends also on a key catalytic loop which inserts from the middle domain into the N-terminal ATP pocket. The middle domain also contains multiple client and co-chaperone binding sites, including that of the ATPase activator Aha1. The C-terminal domain contributes to a four-helix bundle dimer interface with two helices per monomer.

Pharmacological targeting of Hsp90β is known to inhibit some cancers due to its ability to protect many unstable oncogenic proteins from degradation or unfolding. The Hsp90 ATPase inhibitors geldanamycin and its analogues 17-AAG and 17-DMAG are currently in clinical trials. The goal of developing co-chaperone or client-specific inhibitors for targeted treatments requires a greater understanding of chaperone/client interaction sites.

Here we determined the structure of the middle domain of human Hsp90β refined to 2.28 Å resolution.

Materials and Methods

Entry Clone Source: Stefan

Entry Clone Accession: n/a

SGC Construct ID: HSP90B1A-c028

GenBank GI number: gi|20149594

Vector: pNIC-CTHF. Details [ PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified construct sequence:
TTAAGAAGGAGATATACTATGAAGAC
CAAGCCTATTTGGACCAGAAACCCTG
ATGACATCACCCAAGAGGAGTATGGA
GAATTCTACAAGAGCCTCACTAATGA
CTGGGAAGACCACTTGGCAGTCAAGC
ACTTTTCTGTAGAAGGTCAGTTGGAA
TTCAGGGCATTGCTATTTATTCCTCG
TCGGGCTCCCTTTGACCTTTTTGAGA
ACAAGAAGAAAAAGAACAACATCAAA
CTCTATGTCCGCCGTGTGTTCATCAT
GGACAGCTGTGATGAGTTGATACCAG
AGTATCTCAATTTTATCCGTGGTGTG
GTTGACTCTGAGGATCTGCCCCTGAA
CATCTCCCGAGAAATGCTCCAGCAGA
GCAAAATCTTGAAAGTCATTCGCAAA
AACATTGTTAAGAAGTGCCTTGAGCT
CTTCTCTGAGCTGGCAGAAGACAAGG
AGAATTACAAGAAATTCTATGAGGCA
TTCTCTAAAAATCTCAAGCTTGGAAT
CCACGAAGACTCCACTAACCGCCGCC
GCCTGTCTGAGCTGCTGCGCTATCAT
ACCTCCCAGTCTGGAGATGAGATGAC
ATCTCTGTCAGAGTATGTTTCTCGCA
TGAAGGAGACACAGAAGTCCATCTAT
TACATCACTGGTGAGAGCAAAGAGCA
GGTGGCCAACTCAGCTTTTGTGGAGC
GAGTGCGGAAACGGGGCTTCGAGGTG
GTATATATGACCGAGCCCATTGACGA
GTACTGTGTGCAGCAGCTCAAGGAAT
TTGATGGGAAGAGCCTGGTCTCAGTT
ACCAAGGAGGGTCTGGAGCTGGCAGA
GAACCTCTACTTCCAATC

Final protein sequence (Tag sequence in lowercase):
MKTKPIWTRNPDDITQEEYGEFYKSL
TNDWEDHLAVKHFSVEGQLEFRALLF
IPRRAPFDLFENKKKKNNIKLYVRRV
FIMDSCDELIPEYLNFIRGVVDSEDL
PLNISREMLQQSKILKVIRKNIVKKC
LELFSELAEDKENYKKFYEAFSKNLK
LGIHEDSTNRRRLSELLRYHTSQSGD
EMTSLSEYVSRMKETQKSIYYITGES
KEQVANSAFVERVRKRGFEVVYMTEP
IDEYCVQQLKEFDGKSLVSVTKEGLE
Laenlyfq^shhhhhhdykddddk

^ TEV cleave site

Tags and additions: TEV Cleavable C-terminal hexahistidine tag.

Host: BL21 (DE3)R3-pRARE2 (Phage resistant strain).

Growth medium, induction protocol: 10µl of BL21(BE3)-R3-pRARE2 glycerol stock were inoculated into 5ml of TB with 50µg/ml of kanamycin and 34µg/ml chloramphenicol and grown overnight at 37°C, 200rpm. 10ml of overnight culture were added to 1L of TB with 50µg/ml kanamycin and incubated at 37°C, 160rpm. After the OD₆₀₀ reached 1.0, the temperature was dropped to 18°C and 500µl of 1M IPTG was added to the final concentration of ~0.5 mM. The culture was then incubated with shaking overnight at 18°C, 160 rpm. The following morning the 6L culture was harvested and centrifuged for 10min at 40000rpm. Supernatant was discareded and cell pellets were resuspended in 80ml of a lysis buffer and frozen at -80°C.
Lysis buffer: 50 mM HEPES pH 7.5; 500 mM NaCl; 5 mM Imidazole; 5% Glycerol; 1 mM PMSF.
Extraction buffer, extraction method: The thawed cells were broken by 5 passes at 16000 psi through a high pressure homogeniser followed by centrifugation for 45 min at 15000rpm. The supernatant was kept for further purification.

Column 1: Ni-sepharose.

Column 1 Buffer:
Binding Buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 20 mM Imidazole; 5% glycerol; 1 mM PMSF; 0.5 mM TCEP.
Washing Buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 40 mM Imidazole; 5% glycerol; 1 mM PMSF; 0.5 mM TCEP.
Elution Buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 250 mM Imidazole; 5% glycerol; 0.5 mM TCEP.

Column 1 Procedure: 6ml of 50% Ni-sepharose slurry (Amersham) was applied onto a 1.5 x 10cm column. The column was first washed with deionised distilled H₂O, and then equilibrated with 15ml binding buffer. The supernatant was loaded onto the column and the flow through was collected. The column was washed with 30ml of binding buffer and then protein was eluted with 15ml of washing buffer and 10ml of elution buffer.

Enzymatic treatment: The His-tag was cleaved with 1mg TEV per 40mg target protein at 4°C overnight. The cleaved protein was passed again through Ni-sepharose using buffers as above (initial sample diluted 10-fold to decrease imidazole concentration). The flow-through was collected, concentrated to 5ml and loaded onto the GF column.

Column 2: Superdex 75 HiLoad 16/60 (Amersham).

Column 2 Buffers: 10 mM HEPES, pH 7.5; 500 mM NaCl; 5% glycerol; 0.5 mM TCEP.

Column 2 Procedure: Gel filtration was carried out on an ÄKTA Purifier. The extinction at 280nm was monitored and fractions were collected and analysed by SDS-PAGE. Pulled fractions were characterised by mass spectrometry.

Protein concentration: Using MilliPore concentrators with 10kDa cutoff, the sample was concentrated to 11.6mg/ml. concentrations were determined from the absorbance at 280nm using NanoDrop.

Mass spectrometry characterization: The purified native protein was homogeneous and had an experimental mass of 31785Da matching the expected MW = 31784.4Da.Masses were determined by LC-MS, using an Agilent LC/MSD TOF system with reversed-phase HPLC coupled to electrospray ionisation and an orthogonal time-of-flight mass analyser. Proteins were desalted prior to mass spectrometry by rapid elution off a C3 column with a gradient of 5-95% isopropanol in water with 0.1% formic acid.

Crystallisation: Microseeds were prpared from initial crystals obtained from a condition containing 25.5% PEG3350, 0.17M (NH₄)₂SO₄, 15% glycerol. Diffraction-quality crystals were then grown at 20°C in 170µl sitting drops containing 75µl protein (11.6mg/ml), 20µl seed and 75µl of reservoir solution containing 25.5% PEG3350, 0.17M (NH₄)₂SO₄, 15% glycerol. Crystals were vitrified in well solution supplemented with 20% ethylene glycol.

Data Collection: The native crystal diffracted to a resolution of 2.28 Å.
X-ray source: Diamond Light Source beamline I04. .

References

Ali MMU, Roe SM, Vaughan CK, Meyer P, Panaretou B, Piper PW, Prodromou C, Pearl LH: Crystal structure of an Hsp90-nucleotide-p23/Sba1 closed chaperone complex. Nature 2006, 440:1013-1017.
Meyer P, Prodromou C, Hu B, Vaughan C, Roe SM, Panaretou B, Piper PW, Pearl LH: Structural and Functional Analysis of the Middle Segment of Hsp90: implications for ATP hydrolysis and Client Protein and Cochaperone Interactions. Mol Cell 2003, 11:647-658.
Martinez-Yamout MA. Localization of sites of interaction between p23 and Hsp90 in solution. Edited by Venkitakrishnan RP, Preece NE, Kroon G, Wright PE, Dyson HJ. J Biol Chem. 281(20):14457-64. 2006.
Siligardi G, Hu B, Panaretou B, Piper PW, Pearl LH, Prodromou C: Co-chaperone regulation of conformational switching in the Hsp90 ATPase cycle. J Biol Chem. 2004, 279:51989-51998.
Panaretou B, Siligardi G, Meyer P, Maloney A, Sullivan JK, Singh S, Millson SH, Clarke PA, Naaby-Hansen S, Stein R, Cramer R, Mollapour M, Workman P, Piper PW, Pearl LH, Prodromou C: Activation of the ATPase activity of Hsp90 by the stress-regulated cochaperone Aha1. Mol Cell 2002, 10:1307-1318.
Phillips JJ, Yao Z, Zhang W, McLaughlin S, Laue ED, Robinson CV, Jackson SE: Conformational Dynamics of the Molecular Chaperone Hsp90 in Complexes with a Co-chaperone and Anticancer Drugs. J Mol Biol 2007, 372:1189-1203.
Meyer P, Prodromou C, Liao CY, Hu B, Roe SM, Vaughan CK, Vlasic I, Panaretou B, Piper PW, Pearl LH: Structural basis for recruitment of the ATPase activator Aha1 to the Hsp90 chaperone machinery. EMBO J 2004, 23:511-519.