Human microtubule-associated serine/threonine-protein kinase 1 (PDZ domain)

Target ID:

MAST1A

Deposition Date:

Tuesday 30th November 2010

Families:

Protein Kinase

Related Diseases:

CancerSignalling

Structure type:

apo

Download Coordinates:

3PS4

Authors:

Ugochukwu, E., Wang, J., Krojer, T., Muniz, J.R.C., Sethi, R., Pike, A.C.W., Roos, A., Salah, E., Cocking, R., Savitsky, P., Doyle, D.A., von Delft, F., Bountra, C., Arrowsmith, C. H., Weigelt, J., Edwards, A., Knapp, S., Elkins, J.M.

Site:

Oxford

3PS4

tabs

Structure Details

The MAST (Microtubule-Associated Serine/Threonine Kinase) family of kinases is characterised by the presence of a serine/threonine kinase domain and a postsynaptic density protein-95/discs large/zona occludens-1 (PDZ) domain. The family consists of 5 family members, MAST1-4, and MAST-like, the latter of which consists of an elongated kinase domain, and has only weak homology to the other family members. MAST1-4 shares relatively high sequence identity (Garland et al., 2008).

MAST1, which is also called SAST for syntrophin associated serine/threonine kinase, is mainly expressed in the brain but low levels of expression have also been found in ependymal cells and choroid plexus. The precise biological function of MAST1 is not known. MAST1 has been found to associate with β2 syntrophin, and adapter protein via the PDZ domains of both proteins. Both proteins colocalise in cerebral vasculature, spermatic acrosomes and neuronal processes and can associate with microtubules and microtubule-associated proteins such as dystrophin and utrophin potentially leading to phosphorylation and functional regulation of these proteins (Lumeng et al., 1999). Association with the tumour suppressor phosphatase PTEN, a key regulator of cell growth and apoptosis, occurs also via the PDZ domain resulting in phosphorylation of PTEN in the C-terminus and stabilization of the PTEN protein (Valiente et al., 2005). In addition, MAST1 is one of three genes that have been identified in patients with gene duplication or deletion within the locus 19p13.13. Microdeletion of this region manifested itself in overgrowth, macrocephaly, and ophthalmologic and gastrointestinal findings; in contrast, the single microduplication results in growth delay and microcephaly (Dolan et al, 2010). Here we report the structure of the PDZ domain of MAST1.

Materials and Methods

Entry Clone Source: Synthetic

Entry Clone Accession: n/a

SGC Construct ID: MAST1A-c018

GenBank GI number: gi|45120119

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified construct sequence:
ATGCACCATCATCATCATCATTCTTC
TGGTGTAGATCTGGGTACCGAGAACC
TGTACTTCCAATCCATGCGTAGCCCG
ATTACCATTCAGCGTAGCGGCAAAAA
ATATGGTTTTACCCTGCGTGCGATTC
GCGTGTATATGGGCGATACCGATGTT
TATAGCGTTCATCATATTGTTTGGCA
TGTGGAAGAAGGTGGTCCGGCGCAGG
AAGCGGGCCTGTGCGCGGGCGATCTG
ATTACCCATGTGAATGGTGAACCGGT
GCATGGCATGGTTCATCCGGAAGTGG
TTGAACTGATTCTGAAAAGCGGTAAT
AAAGTGGCGGTGACCACCACCCCGTT
TGAAAACACCCAGAGCCTGGTTTGA

Final protein sequence (Tag sequence in lowercase):
smRSPITIQRSGKKYGFTLRAIRVYM
GDTDVYSVHHIVWHVEEGGPAQEAGL
CAGDLITHVNGEPVHGMVHPEVVELI
LKSGNKVAVTTTPFENTQSLV

The N-terminal 2 residues, sm, derive from the vector, following TEV protease cleavage of the hexahistidine tag.

Tags and additions: Cleavable N-terminal His6 tag.

Host: BL-21(DE3)-R3-Rosetta (A homemade phage resistant version of BL21(DE3) containing the pRARE2 plasmid from Rosetta II (DE3) cells)

Growth medium, induction protocol: A number of colonies from the transformation were used to inoculate 1ml of LB media containing 50µg/ml kanamycin and 34µg/ml chloramphenicol, which was placed in a 37°C shaker overnight. The next day glycerol stocks were prepared from this overnight culture. A glycerol stock was used to inoculate 50ml of TB media containing 50µg/ml kanamycin and 34µg/ml chloramphenicol, which was placed in a 37°C shaker overnight. The next day this starter culture was used to inoculate 2x 1L of TB media (18ml starter culture into each) containing 33µg/ml kanamycin. After 3 hours the temperature was reduced to 20°C. After a further 30 minutes the cells were induced by the addition of 0.5 mM IPTC. The expression was continued overnight. Cells were spun at 6000rpm for 15 minutes at 4°C. The cells were resuspended in 30ml of Lysis Buffer with the addition of 0.2 mM PMSF. The resuspended cell pellet was placed in a -80°C.
Lysis Buffer: 50 mM HEPES pH 7.5; 500 mM NaCl; 5% Glycerol; 5 mM Imidazole, pH 7.5; 0.5 mM TCEP.
Extraction buffer, extraction method: The resuspended cell pellet was lysed by sonication. PEI (polyethlyeneimine) was added to a final concentration of 0.25% and the cell debris and preciptated DNA were spun down (18000rpm, JA18 rotor, 40 min).

Column 1: Ni-NTA (2ml volume in a gravity-flow column).

Column 1 Buffer:
Binidng Buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% glycerol; 5 mM Imidazole, pH 7.5; 0.5mM TCEP.
Wash Buffer:50 mM HEPES, pH 7.5; 500 mM NaCl; 5% Glycerol; 25 mM Imidazole, pH 7.5; 0.5 mM TCEP.
Elution Buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% Glycerol; 250 mM Imidazole, pH 7.5; 0.5 mM TCEP.

Column 1 Procedure: The clarified cell extract was passed through the column. The column was then washed with Binding Buffer (25ml) and Wash Buffer (25ml). The protein was eluted with 10ml of Elution Buffer.

Column 2: S200 16/60 Gel Filtration.

Column 2 Buffers: 25 mM HEPES, pH 7.5; 150 mM NaCl; 0.5 mM TCEP.

Column 2 Procedure: The wash 2 and elution fractions from column 1 were combined and concentrated to 4ml volume in a 3kDa MW cutoff spin concentrator.The concentrated sample was injected onto an S200 16/60 column (pre-equilibrated in GF Buffer) at 1.0ml/min. 1.75ml fractions were collected.

TEV protease digestion: Gel filtrations containing MAST1A were combined. TEV protease was added and the sample left at 4°C over night.

Rebinding of impurities to Ni-NTA: The protein was passed through a gravity-flow column containing Ni-NTA resin (2ml resin volume, pre-equilibrated into GF Buffer), the flow-through and eluting with GF buffer containing 30 mM imidazole were combined.

Protein concentration: The TEV protease cleaved protein was concentrated to 13.96mg/ml (measured by 280 nm absorbance), distributed into aliquots and frozen at -80°C.

Mass spectrometry characterization:
Measured: 10810.83.
Expected:10810.

Crystallisation: Crystals grew from a 2:1 ratio of protein to precipitant solution (25 w/v PEG_MME_2000, 85 mM Imidazole pH 6.1, 15 mM Imidazole pH 8.1), using the vapour diffusion method.

Data Collection: Crystals were cryo-protected by equilibration into precipitant solution containing 25% Ethylene glycol, and then flash frozen in liquid nitrogen. Data was collected at the Swiss Light source, beamline X10.

References

Garland, P., Quraishe, S., French, P., and O'Connor, V. (2008). Expression of the MAST family of serine/threonine kinases. Brain research 1195, 12-19.
Lumeng, C., Phelps, S., Crawford, G.E., Walden, P.D., Barald, K., and Chamberlain, J.S. (1999). Interactions between beta 2-syntrophin and a family of microtubule-associated serine/threonine kinases. Nature neuroscience 2, 611-617.
Valiente, M., Andres-Pons, A., Gomar, B., Torres, J., Gil, A., Tapparel, C., Antonarakis, S.E., and Pulido, R. (2005). Binding of PTEN to specific PDZ domains contributes to PTEN protein stability and phosphorylation by microtubule-associated serine/threonine kinases. The Journal of biological chemistry 280, 28936-28943.
Dolan M, Mendelsohn NJ, Pierpont ME, Schimmenti LA, Berry SA, Hirsch B. (2010). A novel microdeletion/microduplication syndrome of 19p13.13. Genet Med. 2010 Aug;12(8):503-511.