Human bromodomain and WD repeat-containing protein 1 isoform A (second bromodomain)

Target ID:

WDR9A

Aliases:

BRWD1C21orf107FLJ43918N143WDR9

Deposition Date:

Monday 20th December 2010

Families:

Bromodomain

Related Diseases:

Epigenetics

Structure type:

apo

Download Coordinates:

3Q2E

Authors:

Filippakopoulos, P., Felletar, I., P., Picaud, S., Keates, T., Krojer, T., Muniz, J., Gileadi, O., Von Delft, F., Arrowsmith, C.H., Edwards, A.M., Weigelt, J., Bountra, C., Knapp, S.

Site:

Oxford

3Q2E

tabs

Structure Details

WDR9 and knows as BRWD1 is a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. WDR9 contains 8 N-terminal WD repeats in addition to 2 bromodomains. Alternative splicing of this gene generates 3 transcript variants diverging at the 3' ends. Interestingly, the WDR9 gene is located within the Down syndrome (DS) region-2 on chromosome 21 suggesting a potential involvement in some of the clinical features associated with DS. In mice, WDR9 is a broadly expressed nuclear protein and expression levels are dynamic during mouse development. WDR9 associates with BRG1, a SWI/SNF complex component and functions as a transcriptional regulator involved in chromatin remodeling. In addition, WDR9 has been reported to be required for normal spermiogenesis and the oocyte?embryo transition and association with the transcription factor Oct4 suggests a role in embryonic stem cell identity and reprogramming. Here we report the structure of the second bromodomain of WDR9.

Materials and Methods

Entry Clone Source: Synthetic

Entry Clone Accession: n/a

SGC Construct ID: WDR9A-c080

GenBank GI number: gi|16445436

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified construct sequence:
CATATGCACCATCATCATCATCATTC
TTCTGGTGTAGATCTGGGTACCGAGA
ACCTGTACTTCCAATCCATGGCGACC
AACTATGTGGAAAGCAACTGGAAAAA
ACAGTGCAAAGAACTGGTGAACCTGA
TTTTTCAGTGCGAAGATAGCGAACCG
TTTCGTCAGCCGGTTGATCTGGTGGA
ATATCCGGATTATCGTGATATCATTG
ATACCCCGATGGATTTTGGCACCGTG
CGCGAAACCCTGGATGCCGGCAACTA
TGATAGCCCGCTGGAATTTTGCAAAG
ATATTCGCCTGATTTTTAGCAACGCG
AAAGCCTATACCCCGAACAAACGCAG
CAAAATCTATAGCATGACCCTGCGTC
TGAGCGCGCTGTTTGAAGAAAAAATG
AAAAAAATTAGCAGCGATTTTAAAAT
TGGTCAGAAATTTAACGAATGACAGT
AAAGGTGGATACGGATCCGAA

Final protein sequence (Tag sequence in lowercase):
mhhhhhhssgvdlgtenlyfq^smAT
NYVESNWKKQCKELVNLIFQCEDSEP
FRQPVDLVEYPDYRDIIDTPMDFGTV
RETLDAGNYDSPLEFCKDIRLIFSNA
KAYTPNKRSKIYSMTLRLSALFEEKM
KKISSDFKIGQKFNE

^ TEV cleavage site

Tags and additions: Cleavable N-terminal His6 tag.

Host: BL21 (DE3)R3-pRARE2 (Phage resistant strain).

Growth medium, induction protocol: 10ml from a 50ml overnight culture containing 50µg/ml kanamycin and 34µg/ml chloramphenicol were used to inoculate each of two 1L cultures of TB containing 50µg/ml kanamycin and 34µg/ml chloramphenicol. Cultures were grown at 37°C until the OD₆₀₀ reached ~2.5 then the temperature was adjusted to 18°C. Expression was induced overnight using 0.1 mM IPTG at an OD₆₀₀ of 3.0. The cells were collected by centrifugation and the pellet re-suspended in binding buffer and frozen.
Binding buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 10 mM Imidazole, 5% Glycerol.
Extraction buffer, extraction method: Frozen pellets were thawed and fresh 0.5 mM TCEP, 1 mM PMSF added to the lysate. Cells were lysed using sonication. The lysate was centrifuged at 17,000 rpm for 60 minutes and the supernatant collected for purification.

Column 1: Ni-affinity. Ni-sepharose (Amersham), 5 ml of 50% slurry in 1.5 x 10 cm column, washed with binding buffer.

Column 1 Buffer:
Binding buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% glycerol; 5 mM imidazole.
Wash buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% glycerol; 30 mM Imidazole.
Elution buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% glycerol; 50 to 250 mM Imidazole (step elution).

Column 1 Procedure: The supernatant was loaded by gravity flow on the Ni-sepharose column. The column was then washed with 30ml wash buffer at gravity flow. The proetin was eluted by gravity flow by applying 5ml portions of elution buffer with increasing concentration of imidazole (50 mM, 100 mM, 150 mM, 200 and 250 mM); fractions were collected until essentially all protein was eluted.

Column 2: Size Exclusion Chromatography. Superdex S75 16/60 HiLoad

Column 2 Buffers: 10 mM HEPS, pH 7.5; 500 mM NaCl; 5% glycerol.

Column 2 Procedure: The protein was concentrated and applied to an S75 16/60 HiLoad gel fitration column equilibrated in 10 mM HEPES, pH 7.5; 500 mM NaCl; 5% glycerol using an ÄKTA express system.

Mass spectrometry characterization: LC- ESI -MS TOF gave a measured mass of 14429 Da for this construct as predicted from the sequence of this protein.

Protein concentration: Protein was concentrated to 9.6mg/ml using an Amicon 3kDa cut-off concentrator.

Crystallisation: Crystals were grown at 4°C in 150nl sitting drops from a 2:1 ratio of protein to reseroir solution containing 0.2M (NH₄)OOCCH₃, 0.1M bis tris pH 5.5 and 25% PEG3350.

Data Collection: Crystals were cryo-protected using the well solution supplemented by 20% ethylene glycol and flash frozen in liquid nitrogen.
X-ray source: Diffraction data were collected from a single crystal on diamond bealine I02 at a single wavelength of 0.97Å. The final structure was refined to 1.66Å.
Phasing: The structure was solved by molecular replacement using an ensemble of known bromodomain structure as a starting model.

References

D'Costa, A., Reifegerste, R., Sierra, S., and Moses, K. (2006). The Drosophila ramshackle gene encodes a chromatin-associated protein required for cell morphology in the developing eye. Mech Dev 123, 591-604.
Dubinsky, M.C., Mei, L., Friedman, M., Dhere, T., Haritunians, T., Hakonarson, H., Kim, C., Glessner, J., Targan, S.R., McGovern, D.P., Taylor, K.D., and Rotter, J.I. (2010). Genome wide association (GWA) predictors of anti-TNFalpha therapeutic responsiveness in pediatric inflammatory bowel disease. Inflamm Bowel Dis 16, 1357-1366.
Huang, H., Rambaldi, I., Daniels, E., and Featherstone, M. (2003). Expression of the Wdr9 gene and protein products during mouse development. Dev Dyn 227, 608-614.
Levine, M.M., and Levine, O.S. (1994). Changes in human ecology and behavior in relation to the emergence of diarrheal diseases, including cholera. Proc Natl Acad Sci U S A 91, 2390-2394.
Philipps, D.L., Wigglesworth, K., Hartford, S.A., Sun, F., Pattabiraman, S., Schimenti, K., Handel, M., Eppig, J.J., and Schimenti, J.C. (2008). The dual bromodomain and WD repeat-containing mouse protein BRWD1 is required for normal spermiogenesis and the oocyte-embryo transition. Dev Biol 317, 72-82.
Ramos, V.C., Vidal-Taboada, J., Bergonon, S., Egeo, A., Fisher, E.M., Scartezzini, P., and Oliva, R. (2002). Characterisation and expression analysis of the WDR9 gene, located in the Down critical region-2 of the human chromosome 21. Biochim Biophys Acta 1577, 377-383.