Human plextrin homology domain of IQ motif and SEC7 domain-containing protein 1

Target ID:

IQSEC1A

Deposition Date:

Monday 28th February 2011

Families:

Miscellaneous

Related Diseases:

Cancer

Structure type:

apo

Download Coordinates:

3QWM

Authors:

P. Filippakopoulos, S. Picaud, I. Felletar, S. Feller, M. Janning, H. Sabe, T. Krojer, A. Chaikuad, C. Allerston, F. von Delft, C. Bountra, C.H. Arrowsmith, J. Weigelt, A. Edwards, S. Knapp

Site:

Oxford

3QWM

tabs

Structure Details

IQSEC1, IQ motif and SEC7 domain-containing protein 1, is a member of the BRAG family, which in humans consist of three members: BRAG1 (IQSEC1, ARFGEF100, GEP100), BRAG2 (IQSEC2) and BRAG3.

IQSEC1 is widely expressed and functions as guanine nucleotide exchange factor for ARF (ARFGEF), promoting the activation of ARF by accelerating the exchange from ARF-GDP to ARF-GTP. IQSEC1 mainly acts on ARF6, which results in actin-cytoskeleton alterations, disruption of stress fibers and changes in cell shape (Dunphy et al., 2006; Hiroi et al., 2006). IQSEC1 is also involved in E-cadherin recycling and internalisation of beta-1 integrin thereby controlling cell adhesion (Hiroi et al., 2006; Sabe et al., 2009) (Dunphy et al., 2006). Like its Drosophila homologue, Loner, IQSEC1 is essential for formation and elongation of myotubes. Recently, a potential role in homing of hematopoietic stem cells has been suggested as well (Pajcini et al., 2008).

IQSEC1 has been named after the modules making up the protein; the N-terminal IQ-like motif is followed by a central serine-rich region and a Sec7 domain. C-terminal to the Sec7 domain a pleckstrin homology domain is located. IQ motives typically bind calmodulin in the absence of calcium. However, incomplete IQ motives like the one found in IQSEC1 usually bind calmodulin in a calcium dependent manner (Bahler and Rhoads, 2002). PH domains have originally been identified as domains required for phosphoinositide binding and membrane association. The PH domain of IQSEC1, however, lacks critical residues important for phosphoinositide binding and has accordingly been shown to bind phospho-tyrosines (Morishige et al., 2008). IQSEC1 binds directly to the phosphorylated tyrosines (Tyr 1068/1086) of EGFR upon ligand stimulation resulting in activation of ARF6 and invasiveness as well as metastasis of some breast cancer cells. Moreover, co-expression of IQSEC1 and EGFR has been shown to correlate with tumour grade (Morishige et al., 2008; Sabe et al., 2009). Here we report the structure of the PH domain of IQSEC1 at 2.3Å resolution.

Materials and Methods

Entry Clone Source: Stephan Feller Oxford University

Entry Clone Accession: n/a

SGC Construct ID: IQSEC1A-c001

GenBank GI number: gi|197304786

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified construct sequence:
CATATGCACCATCATCATCATCATTC
TTCTGGTGTAGATCTGGGTACCGAGA
ACCTGTACTTCCAATCCATGGGCTGT
GTGCTCTCTCTGCCCCACCGTCGGTT
GGTCTGCTACTGCCGGCTCTTTGAGG
TTCCAGACCCAAACAAGCCCCAGAAA
CTCGGACTACACCAGCGAGAAATCTT
CCTGTTCAACGACCTCCTGGTGGTCA
CCAAGATCTTCCAGAAGAAGAAGAAC
TCGGTGACGTACAGCTTCCGACAGTC
CTTCTCCTTGTACGGCATGCAGGTCC
TGCTCTTCGAGAACCAGTACTACCCC
AATGGCATCCGGCTCACCTCGTCTGT
CCCCGGAGCAGATATCAAAGTGTTAA
TAAACTTCAACGCCCCCAACCCTCAA
GACCGGAAGAAATTCACCGATGACCT
GCGGGAGTCCATTGCGGAAGTCCAAG
AGATGGAGAAGCACAGGATAGAGTCG
GAGCTCGAGAAGCAGAAATGACAGTA
AAGGTGGATACGGATCCGAA

Final protein sequence (Tag sequence in lowercase):
mhhhhhhssgvdlgtenlyfq^smGC
VLSLPHRRLVCYCRLFEVPDPNKPQK
LGLHQREIFLFNDLLVVTKIFQKKKN
SVTYSFRQSFSLYGMQVLLFENQYYP
NGIRLTSSVPGADIKVLINFNAPNPQ
DRKKFTDDLRESIAEVQEMEKHRIES
ELEKQK

^ TEV cleavage site

Tags and additions: Cleavable N-terminal His6 tag.

Host: BL21 (DE3)R3-pRARE2 (Phage resistant strain).

Growth medium, induction protocol: 10ml from a 50ml overnight culture containing 50µg/ml kanamycin and 34µg/ml chloramphenicol were used to inoculate each of two 1L cultures of TB containing 50µg/ml kanamycin and 34µg/ml chloramphenicol. Cultures were grown at 37°C until the OD₆₀₀ reached ~2.5 then the temperature was adjusted to 18°C. Expression was induced overnight using 0.1 mM IPTG at an OD₆₀₀ of 3.0. The cells were collected by centrifugation and the pellet re-suspended in binding buffer and frozen.
Lysis buffer: 20 mM TRIS, pH 8.5; 500 mM NaCl; 5 mM Imidazole; 5% Glycerol.
Extraction buffer, extraction method: Frozen pellets were thawed and fresh 0.5 mM TCEP, 1 mM PMSF added to the lysate. Cells were lysed by high pressure cell disrupter. The lysate was centrifuged at 17,000rpm for 60 minutes and the supernatant collected for purification.

Column 1: Ni-affinity. Ni-sepharose (Amersham), 5ml of 50% slurry in 1.5x10cm column, washed with binding buffer.

Column 1 Buffers:
Binding buffer: 20 mM TRIS, pH 8.5; 500 mM NaCl; 5% glycerol; 5 mM Imidazole.
Wash buffer: 20 mM TRIS, pH 8.5; 500 mM NaCl; 5% glycerol; 30 mM Imidazole.
Elution buffer: 20 mM TRIS, pH 8.5; 500 mM NaCl; 5% glycerol; 50 to 400 mM Imidazole.

Column 1 Procedure: The supernatant was loaded by gravity flow on the Ni-sepharose column. The column was then washed with 30ml wash buffer at gravity flow. The protein was eluted by gravity flow by applying 5ml portions of elution buffer with increasing concentration of imidazole (50, 100, 150, 200, 250 and 400 mM) fractions were collected until essentially all protein was eluted.

Enzymatic treatment: The N-terminal His tag was cleaved by treatment with TEV protease, overnight.

Column 2: Size Exclusion Chromatography. Superdex S75 16/60 HiLoad.

Column 2 Buffer: 20 mM TRIS, pH 8.5; 300 mM NaCl; 5% glycerol.

Column 2 Procedure: The protein was concentrated and applied to an S75 16/60 HiLoad gel filtration column equilibrated in 20 mM TRIS pH 8.5, 300 mM NaCl, 5% glycerol using an ÄKTA express system

Mass spectrometry characterization: LC- ESI -MS TOF gave a measured mass of 16409Da for this construct as predicted from the sequence of this protein.

Protein concentration: Protein was concentrated to 3.7mg/ml using an Amicon 10kDa cut-off concentrator.

Crystallisation: Crystals grown at 4°C using a protein solution (3.7mg/ml) and a reservoir solution containing 17.5% PEG3350, 0.2 M NaNO₃, 10% Ethylene glycole, 1.0 M BTProp pH 8.25.

Data collection: Crystals were cryo-protected using the well solution supplemented by 20% ethylene glycol and flash frozen in liquid nitrogen.
X-ray source: Diffraction data were collected from a single crystal on a Diamond beamline IO3, the structure was refined to 2.06Å.

References

Bahler, M., and Rhoads, A. (2002). Calmodulin signaling via the IQ motif. FEBS Lett 513, 107-113.
Dunphy, J.L., Moravec, R., Ly, K., Lasell, T.K., Melancon, P., and Casanova, J.E. (2006). The Arf6 GEF GEP100/BRAG2 regulates cell adhesion by controlling endocytosis of beta1 integrins. Curr Biol 16, 315-320.
Hiroi, T., Someya, A., Thompson, W., Moss, J., and Vaughan, M. (2006). GEP100/BRAG2: activator of ADP-ribosylation factor 6 for regulation of cell adhesion and actin cytoskeleton via E-cadherin and alpha-catenin. Proc Natl Acad Sci U S A 103, 10672-10677.
Morishige, M., Hashimoto, S., Ogawa, E., Toda, Y., Kotani, H., Hirose, M., Wei, S., Hashimoto, A., Yamada, A., Yano, H., et al. (2008). GEP100 links epidermal growth factor receptor signalling to Arf6 activation to induce breast cancer invasion. Nat Cell Biol 10, 85-92.
Pajcini, K.V., Pomerantz, J.H., Alkan, O., Doyonnas, R., and Blau, H.M. (2008). Myoblasts and macrophages share molecular components that contribute to cell-cell fusion. J Cell Biol 180, 1005-1019.
Sabe, H., Hashimoto, S., Morishige, M., Ogawa, E., Hashimoto, A., Nam, J.M., Miura, K., Yano, H., and Onodera, Y. (2009). The EGFR-GEP100-Arf6-AMAP1 signaling pathway specific to breast cancer invasion and metastasis. Traffic 10, 982-993.