BAR domain of human amphiphysin, isoform 1 .

Target ID:

AMPHA

Deposition Date:

Thursday 30th June 2011

Families:

Miscellaneous

Structure type:

apo

Download Coordinates:

3SOG

Authors:

C.K.Allerston., Krojer, T., Chaikuad, A., Cooper, C.D.O., Berridge, G., Savitsky, P., Vollmar, M., Von Delft, F., Arrowsmith, C.H.. Weigelt, J., Edwards, A., Bountra, C., Gileadi, O.

Site:

Oxford

3SOG

tabs

Structure Details

Amphiphysin is enriched in brain tissue, and is associated with the cytoplasmic surface of synaptic vesicles. Amphiphysin consists of an N-terminal BAR domain and a C-terminal SH3 domain, with the intervening region predicted to be largely unstructured. BAR domains are alpha-helical bundles with a characteristic curvature, which is thought to bind to organelle membranes and either sense or regulate membrane curvature. AMPH in brain is associated with clathrin-coated synaptic vesicles, and binds to dynamin (through the SH3 domain) and clathrin (through the central domain), to the p35 regulatory subunit of CDK5. AMPH also directly interacts with the membrane through the BAR domain. BAR domains form homo- or hetero-dimers; there is evidence that AMPH and BIN1 may heterodimerize. Bin1 is associated with multiple processes and genetic variants are associated with increased risk of Alzheimer disease.

We present the structure of the N-terminal BAR domain of human AMPH at 2.3Å resolution.

Materials and Methods

Entry Clone Source: MGC

Entry Clone Accession: IMAGE:5181100

SGC Construct ID: AMPHA-c013

GenBank GI number: gi|4502081

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified construct sequence:
ATGCACCATCATCATCATCATTCTTC
TGGTGTAGATCTGGGTACCGAGAACC
TGTACTTCCAATCCATGACAAAAGAC
GAACAGTTCGAAGAATATGTCCAGAA
CTTCAAACGGCAAGAAGCAGAGGGTA
CCAGACTTCAGCGAGAACTCCGAGGA
TATTTAGCAGCAATCAAAGGCATGCA
GGAGGCCTCCATGAAGCTCACAGAGT
CGCTGCATGAAGTCTATGAGCCTGAC
TGGTATGGGCGGGAAGATGTGAAAAT
GGTTGGTGAGAAATGTGATGTGCTGT
GGGAAGACTTCCATCAAAAACTCGTG
GATGGGTCCTTGCTAACACTGGATAC
CTACCTGGGGCAATTTCCTGACATAA
AGAATCGCATCGCCAAGCGCAGCAGG
AAGCTAGTGGACTATGACAGTGCCCG
CCACCATCTGGAAGCTCTGCAGAGCT
CCAAGAGGAAGGATGAGAGTCGAATC
TCTAAGGCAGAAGAAGAATTTCAGAA
AGCACAGAAAGTGTTTGAAGAGTTTA
ACGTTGACTTACAAGAAGAGTTACCA
TCATTATGGTCAAGACGAGTTGGATT
TTATGTTAATACTTTCAAAAACGTCT
CCAGCCTTGAAGCCAAGTTTCATAAG
GAAATTGCGGTGCTTTGCCACAAACT
GTATGAAGTGATGACAAAACTGGGTG
ACTGA

Final protein sequence (Tag sequence in lowercase):
mhhhhhhssgvdlgtenlyfq^smTK
DEQFEEYVQNFKRQEAEGTRLQRELR
GYLAAIKGMQEASMKLTESLHEVYEP
DWYGREDVKMVGEKCDVLWEDFHQKL
VDGSLLTLDTYLGQFPDIKNRIAKRS
RKLVDYDSARHHLEALQSSKRKDESR
ISKAEEEFQKAQKVFEEFNVDLQEEL
PSLWSRRVGFYVNTFKNVSSLEAKFH
KEIAVLCHKLYEVMTKLGD

^ TEV cleavage site

Tags and additions: Cleavable N-terminal His6 tag.

Host: BL21 (DE3)R3-pRARE2 (Phage resistant strain).

Growth medium, induction protocol: The expression plasmid was transformed into the host strain and plated on LB-agar containing 50µg/ml kanamycin and 34µg/ml chloramphenicol. Several colonies were combined to inoculate a 1ml culture in TB (+ 50µg/ml kanamycin, 34µg/ml chloramphenicol). The culture was grown overnight, glycerol was added to 15% v/v (from a 60% stock), and the resulting glycerol stock was frozen at -80°C in 100µl aliquots. A loopful of cells from the glycerol stock was inoculated into 20ml of TB medium containing 50µg/ml kanamycin and 34µg/ml chloramphenicol and grown overnight at 37°C. 2x1L TB medium (containing 50µg/ml kanamycin) were each inoculated with 10ml of the overnight culture and grown in 2.5L UltraYield baffled flasks until OD₆₀₀ of 3.0. Cells were cooled to 18°C, IPTG added to 0.1 mM and growth continued at 18°C overnight. The cells were collected by centrifugation then the pellets were scraped out and transferred to 50ml Falcon tubes and frozen at -80°C.
Lysis buffer: 25 mM Tris buffer, pH 8.0; 500 mM NaCl; 5 mM Imidazole; 10% glycerol; 0.5 mM TCEP; 1x Protease Inhibitors Cocktail Set VII (Calbiochem, 1/1000 dilution).
2x Lysis buffer contains the same components at double concentration.
Extraction method: Frozen cell pellets (86g) were thawed briefly in a bath of warm water (20 - 37°C) then transferred to ice. One volume (i.e. 1ml for every gram of cells) of 2x lysis buffer was added, followed by 1x lysis buffer to a total volume of 300ml. The cells were resuspended by agitating and disrupted by sonication. Nucleic acids and cell debris were removed by adding 0.15% PEI (polyethyleneimine) from a 5% (w/v, pH 7.5) stock, stirring for 15 minutes, then centrifugation for 1 hour at 25,000g.

Column 1: Histrap FF 5ml (GE Healthcare).

Column 1 Buffers:
Affinity buffer: 25 mM Tris, pH 8.0; 100 mM KCl; 10% glycerol; 0.5 mM TCEP; 30 mM Imidazole.
Wash buffer: 25 mM Tris, pH 8.0; 100 mM KCl; 10% glycerol; 0.5 mM TCEP; 30 mM Imidazole.
Elution buffer: 25 mM Tris, pH 8.0; 100 mM KCl; 10% glycerol; 0.5 mM TCEP; 300 mM Imidazole.

Column 1 Procedure: The cell extract was loaded onto the column at 5ml/min on an ÄKTA-express system (GE Healthcare). The column was then washed with 10 volumes of loading buffer, 10 volumes of wash buffer, then eluted with elution buffer at 4ml/min. The eluted peak of A₂₈₀ was automatically collected.

Enzymatic treatment: The eluted protein was treated with TEV protease (His₆-tagged) overnight at 4°C, while being dialysed in 25 mM Tris, pH 8, 100 mM KCl, 10% glycerol, 1 mM TCEP, using 3000 MWCO dialysis tubing. The protease and other impurities were removed by passing through a 1ml Histrap column.

Column 2: Gel filtration, HiLoad 16/60 Superdex 75, 120ml.

GF Buffer: 25 mM Tris, pH 8.0; 100 mM KCl; 10% glycerol; 1 mM TCEP.

Column 2 Procedure: The protein was loaded and fractionated on the gel filtration column in GF buffer at 1.2ml/min. 2ml fractions were collected at the A₂₈₀ peaks. The fractions were analyzed by SDS-PAGE and relevant fractions were pooled. This column resulted in a unique peak of the AMPH protein, at an elution volume compatible with a dimer.

Protein concentration: The protein was concentrated to 14.5mg/ml (concentrations estimated by A₂₈₀, using an extinction coefficient of 28480 and molecular mass of 24180Da).

Mass spectrometry characterization: ESI-TOF Mass spectrometry revealed a mass of 24,181.41Da, compared to the predicted 24,180.4Da (after tag cleavage).

Crystallisation: Crystals were grown by vapor diffusion at 4°C in 150nl sitting drops. A crystal was grown by mixing 75nl of protein solution (14.5mg/ml) and 75nl of precipitant consisting of 2.66% PEG 6000, 2.66% PEG 8000, 2.66% PEG 10,000, 0.02 M Magnesium Acetate, 0.05 M Potassium Chloride 0.1 M MES pH 6.2. Crystals appeared in about a week at 4°C. Crystals were cryo-protected by bathing the crystal in mother liquor supplemented with 25% Ethylene glycol and flash-freezing in liquid nitrogen. This crystal was used to collect a native dataset.
Another crystal was grown by mixing 50nl of protein solution and 100nl of precipitant consisting of 2.66% PEG 6000, 2.66% PEG 8000, 2.66% PEG 10,000, 0.05 M Magnesium Acetate, 0.02 M Potassium Chloride 0.1 M MES pH 6.2. Crystals appeared in about a week at 4°C. The crystals were soaked for 35 minutes with 5 mM Thiomersal, before cryoprotection in mother liquor supplemented with 25% Ethylene glycol and flash-freezing in liquid nitrogen.

Data collection: Diffraction data for the native dataset were collected from a single crystal at the Diamond synchrotron beamline I04-1, at a wavelength of 0.9795Å.
Diffraction data for the derivatised crystal was collected from a single crystal on a Bruker in-house source.
The protein crystallised in space group P31 1 2 with one molecule in the asymmetric unit. Initial phase estimations using molecular replacement of the native resolution data set proved insufficient to build and refine the model. 2 mercury sites were unambiguously identified using SHELXD, with an anomalous signal extending to 4-5Å. The derivatised crystal dataset was used with the native dataset in a SIRAS experiment in SHARP, with solvent flattening in SOLOMAN, resulting in an electron density map clearly showing distinctive coiled-coils, typical of BAR domains. The model was built in COOT, utilising the heavy-atom sites to guide placement of the amino acid sequence register, and refined to a final resolution of 2.3Å using BUSTER-TNT.