Human FYVE domain of endofin

Target ID:

ZFYVE16A

Deposition Date:

Saturday 30th July 2011

Families:

Miscellaneous

Structure type:

apo

Download Coordinates:

3T7L

Authors:

Chaikuad, A., Williams, E., Guo, K., Sanvitale, C., Berridge, G., Krojer, T., Muniz, J.R.C., Canning, P., Phillips, C., Shrestha, A., von Delft, F., Weigelt, J., Arrowsmith, C.H., Edwards, A.M., Bountra, C., Bullock, A

Site:

Oxford

3T7L

tabs

Structure Details

Human endofin (also known as ZFYVE16, zinc finger FYVE domain-containing protein 16) is a 1539 residue protein containing a central FYVE domain [1]. The FYVE domain (for conserved in Fab1, YOTB, Vac1 and EEA1) is an 80 amino acid motif that binds to phosphatidylinositol 3-phosphate (PtdIns3P, PI3P) with high specificity and affinity [2-5]. PtdIns3P is the major product of class III PI 3-kinase Vps34 and is found mainly in endosomes. Through the binding of PtdIns3P, the FYVE domain directs proteins for endosomal trafficking and is therefore found in a number of signal transduction proteins [2-5]. Overall, the FYVE domain is highly evolutionarily conserved from yeast to humans (occurring in 38 human proteins). The domain consists of a double zinc finger built from two small β-sheets and a C-terminal α-helix [6]. A conserved (R/K)(R/K)HHCR motif is critical for PtdIns3P binding [7, 8].

Endofin is expressed widely in different tissues. Expression is highest in the kidney, placenta and lung and weakest in the colon, thymus and peripheral blood lymphocytes [1]. Endofin is most closely related to SARA (Smad anchor for receptor activation) [1, 9]. SARA binds directly to Smad2/3 [10] and presents the Smad MH2 domain for binding to the type I TGF-β receptor [11]. The FYVE domain in SARA then directs the internalization of the receptor signaling complex to the early endosome for trafficking to the nucleus, where the phosphorylated Smad modulates target gene transcription [11]. Endofin is thought to function similarly as a Smad anchor for BMP receptors and binds preferentially to Smad1 [9, 12]. In addition, endofin and SARA recruit the phosphatase PP1 leading to receptor dephosphorylation, which may act to fine tune the signaling response [12]. In a yeast two-hybrid screen the C-terminal half of endofin was also found to bind TOM1 and functions also to recruit TOM1 to endosomes [13]. Finally, endofin undergoes tyrosine phosphorylation upon EGF stimulation and may be associated with the EGFR signaling network [14, 15].

Here we determined the structure of the FYVE domain of human endofin refined at 1.1Å resolution.

Materials and Methods

Entry Clone Source: MGC

Entry Clone Accession: BC032227

SGC Construct ID: ZFYVE16A-c008

GenBank GI number: gi|157426864

Vector: pNIC-Zb.

Amplified construct sequence:
TACTTCCAATCCATGGAAGGCTTGGT
TTTGGGCCAGAAACAGCCTACTTGGG
TTCCTGATTCAGAAGCTCCAAACTGT
ATGAACTGCCAAGTCAAATTTACTTT
TACCAAACGGCGACACCATTGCCGAG
CATGTGGGAAAGTATTTTGTGGTGTC
TGTTGTAATAGGAAGTGTAAACTGCA
ATATCTAGAAAAGGAAGCAAGAGTAT
GTGTAGTCTGCTATGAAACTATTAGT
AAAGCTCAGGCATTTGAAAGGATGAT
GAGTCCAACTGGTTCTAATCTTAAGT
CTAATCATTCTGATGAATGTACTACT
GTCCAGCCTCCTCAGGAGAACCAAAC
ATCCAGTATACCTTCACCAGCAACTT
TGCCAGTCTCAGCACTTAAACAACCA
GGTGTTGAAGGACTATGACAGTAAAG
GTGGATA

Final protein sequence (Tag sequence in lowercase):
mhhhhhhssgvdnkfnkerrrarrei
rhlpnlnreqrrafirslrddpsqsa
nllaeakklndaqpkgtenlyfq^sm
EGLVLGQKQPTWVPDSEAPNCMNCQV
KFTFTKRRHHCRACGKVFCGVCCNRK
CKLQYLEKEARVCVVCYETISKAQAF
ER*MMSPTGSNLKSNHSDECTTVQPP
QENQTSSIPSPATLPVSALKQPGVEG
L

^ TEV cleavage site
* Limited tryptic digestion is thought to have cleaved the protein here for crystallisation

Tags and additions: N-terminal hexahistidine tag and Z tag cleavable by TEV protease (^).

Host: BL21 (DE3)R3-pRARE2 (Phage resistant strain).

Growth medium, induction protocol: 50 mL of LB was inoculated with 1µl of glycerol stock and incubated overnight at 37°C while shaking in the presence of 50µg/ml kanamycin and 34µg/ml chloramphenicol. 1L of LB was inoculated with 10mL of overnight culture and grown while shaking at 37°C in the presence of antibiotic. Cultures were induced with 0.5 mM IPTG at OD₆₀₀ = 0.9 and grown overnight at 21°C before harvesting by centrifugation.
Lysis buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% Glycerol; 0.5 mM TCEP.
Extraction buffer, extraction method: The frozen cells were thawed and lysed in lysis buffer by passage 4-5x through an Emulsiflex C5 homogenizer. The DNA was precipitated using 0.15% PEI (polyethyleneimine) pH 8. The cell lysate was spun down by centrifugation at 21.5K rpm at 4°C for 1h. The supernatant was recovered for purification.

Column 1: Cation-exchange using a 5ml Hi Trap HP SP column (Amersham). The column was pre-equilibrated with binding buffer.

Column 1 Buffers:
Binding buffer : 50 mM HEPES, pH 7.5; 50 mM NaCl; 0.5 mM TCEP.
Elution buffer : 50 mM HEPES, pH 7.5; 1 M NaCl; 0.5 mM TCEP.

Column 1 Procedure: The supernatant was diluted by 50% with 50 mM HEPES pH 7.5 to reduce the ionic strength sufficiently to bind to the resin. The supernatant was applied onto the column using an ÄKTA purifier, which was then washed with 25mL binding buffer. ZFYVE16 protein was then eluted by applying a gradient of Elution buffer from 50 mM to 1 M NaCl at 1ml/min for 1h. 1.5mL fractions were collected across the entire gradient.

Column 2: Size Exclusion Chromatography - S75 HiLoad 16/60 Superdex run on ÄKTA-Express.

Gel Filtration Buffer: 50 mM HEPES, pH 7.5; 300 mM NaCl; 0.5 mM TCEP.

Column 2 Procedure: Prior to applying the protein, the S75 16/60 column was washed and equilibrated with gel filtration buffer. The protein was concentrated to 3ml using an Amicon Ultra-15 filter with a 10kDa cut-off. The concentrated protein was directly applied onto the equilibrated S75 16/60 column, and run at a flow-rate of 1ml/min. Fractions containing the protein were pooled together.

Enzymatic treatment: The tag was cleaved with TEV after Column 1 and the tag removed during gel filtration.

Mass spectrometry characterization: The purified protein was homogeneous and had an experimental mass of 14596.7Da. The theoretical expected mass from the construct primary sequence is 14596.9Da. Masses were determined by LC-MS, using an Agilent LC/MSD TOF system with reversed-phase HPLC coupled to electrospray ionisation and an orthogonal time-of-flight mass analyser. Proteins were desalted prior to mass spectrometry by rapid elution off a C3 column with a gradient of 5-95% methanol in water with 0.1% formic acid.

Protein concentration: Protein was concentrated to 15mg/ml using an Amicon 10kDa cut-off concentrator.

Crystallisation: Protein was used at 8.9mg/ml in gel filtration buffer. Trypsin was added to the final sample at a concentration of 10µg/mL for limited in situ proteolysis during crystallisation. Crystals were grown at 4°C in 150nl sitting drops mixing 50nl protein solution with 100nl of a reservoir solution containing 20 mM NaNO₃, 20% PEG 3350, 10% Ethylene Glycol. On mounting crystals were cryo-protected with an additional 20% ethylene glycol.

Data collection: 1.1Å resolution.
X-ray source: Diamond Light Source beamline I04, λ = 0.9611Å.

References

Seet, L.F. and W. Hong, Endofin, an endosomal FYVE domain protein. J Biol Chem, 2001. 276(45): p. 42445-54.
Corvera, S., Signal transduction: stuck with FYVE domains. Sci STKE, 2000. 2000(37): p. pe1.
Hayakawa, A., et al., Evolutionarily conserved structural and functional roles of the FYVE domain. Biochem Soc Symp, 2007(74): p. 95-105.
Kutateladze, T.G., Phosphatidylinositol 3-phosphate recognition and membrane docking by the FYVE domain. Biochim Biophys Acta, 2006. 1761(8): p. 868-77.
Birkeland, H.C. and H. Stenmark, Protein targeting to endosomes and phagosomes via FYVE and PX domains. Curr Top Microbiol Immunol, 2004. 282: p. 89-115.
Misra, S. and J.H. Hurley, Crystal structure of a phosphatidylinositol 3-phosphate-specific membrane-targeting motif, the FYVE domain of Vps27p. Cell, 1999. 97(5): p. 657-66.
Kutateladze, T. and M. Overduin, Structural mechanism of endosome docking by the FYVE domain. Science, 2001. 291(5509): p. 1793-6.
Dumas, J.J., et al., Multivalent endosome targeting by homodimeric EEA1. Mol Cell, 2001. 8(5): p. 947-58.
Murphy, C., Endo-fin-ally a SARA for BMP receptors. J Cell Sci, 2007. 120(Pt 7): p. 1153-5.
Wu, G., et al., Structural basis of Smad2 recognition by the Smad anchor for receptor activation. Science, 2000. 287(5450): p. 92-7.
Tsukazaki, T., et al., SARA, a FYVE domain protein that recruits Smad2 to the TGFbeta receptor. Cell, 1998. 95(6): p. 779-91.
Shi, W., et al., Endofin acts as a Smad anchor for receptor activation in BMP signaling. J Cell Sci, 2007. 120(Pt 7): p. 1216-24.
Seet, L.F., et al., Endofin recruits TOM1 to endosomes. J Biol Chem, 2004. 279(6): p. 4670-9.
Chen, Y., et al., Phosphoproteomics identified Endofin, DCBLD2, and KIAA0582 as novel tyrosine phosphorylation targets of EGF signaling and Iressa in human cancer cells. Proteomics, 2007. 7(14): p. 2384-97.
Toy, W., et al., EGF-induced tyrosine phosphorylation of Endofin is dependent on PI3K activity and proper localization to endosomes. Cell Signal, 2010. 22(3): p. 437-46.