tandem bromodomains of human Transcription initiation factor TFIID subunit 1 (TAF1)

Target ID:

TAF1A

Deposition Date:

Tuesday 29th November 2011

Families:

Bromodomain

Related Diseases:

CancerSignalling

Structure type:

apo

Download Coordinates:

3UV5

Authors:

Filippakopoulos, P., Felletar, I., Picaud, S., Keates, T., Muniz, J., Gileadi, O., von Delft, F., Arrowsmith, C.H., Edwards, A.M., Weigelt, J., Bountra, C., Knapp, S.

Site:

Oxford

3UV5

tabs

Structure Details

Double Bromodomain of TAF1 (TATA box binding protein (TBP)-associated factor)

PDB Code: 3uv5

Initiation of transcription requires the recruitment of a large multiprotein complex to transcriptional start sites. The central protein of that complex is the basal transcription factor TFIID, which binds to the core promoter and which serves as the scaffold for assembly of about 70 proteins that constitute the transcription initiation complex. TFIID is composed of the DNA binding TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as co-activators and function in promoter recognition or modify general transcription factors by facilitating assembly of regulatory complexes. The TAF1 gene encodes a protein of 250 kDa, the core protein of the TFIID complex which binds to core promoter sequences encompassing the transcription start site as well as to other transcriptional regulators. TAF1 possesses acetyltransferase activity and can act as an ubiquitin-activating/conjugating enzyme and contains a double bromodomain acetyl-lysine interaction module. Kinase activity has also been reported for TAF1. However, there is no classical kinase domain present in the coding region of TAF1. It is therefore likely that this activity is due to tight association of TAF1 with a protein kinase such as CK2 which may play role in the maintenance of Mdm2 phosphorylation and function by TAF1.

Dysfunction of TAF1 has been associated with a number of diseases. For instance, TAF1 expression has been associated with progression of human prostate cancers to the lethal castration-resistant state. TAF1 interacts with the androgen receptor (AR) and co-localizes with AR on the prostate-specific antigen promoter/enhancer in prostate cancer cells. In addition, reduced neuron-specific expression of the TAF1 gene due to a retrotransposon insertion in a TAF1 intron has been associated with X-linked dystonia-parkinsonism (XDP). The structure of the TAF1 double bromodomain has been reported previously. However, to enable discovery of low molecular weight inhibitors that target the TAF1 bromodomains and to gain insight into the flexibility of the linker regions that connects the two BRDs we crystallized the double bromodomain of TAF1 in an alternative space group and the second bromodomain of TAF1(2).

Materials and Methods

Entry Clone Source: Synthetic

Entry Clone Accession: GI:20357585

Vector: pNIC28-Bsa4 Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified DNA sequence:
CATATGCACCATCATCATCATCATTC
TTCTGGTGTAGATCTGGGTACCGAGA
ACCTGTACTTCCAATCCATGAGCATT
CATCGTCGTCGTACCGATCCGATGGT
GACCCTGAGCAGCATTCTGGAAAGCA
TTATCAACGATATGCGCGATCTGCCG
AACACCTATCCGTTTCATACCCCGGT
TAACGCGAAAGTGGTTAAAGATTATT
ATAAAATTATCACCCGTCCGATGGAT
CTGCAGACCCTGCGCGAAAACGTTCG
TAAACGTCTGTATCCGAGCCGCGAAG
AATTTCGTGAACATCTGGAACTGATT
GTGAAAAATAGCGCGACCTATAATGG
CCCGAAACACAGCCTGACCCAGATTA
GCCAGAGCATGCTGGATCTGTGCGAT
GAAAAACTGAAAGAAAAAGAAGATAA
ACTGGCGCGCCTGGAAAAAGCCATTA
ATCCGCTGCTGGATGATGATGATCAG
GTGGCCTTTAGCTTCATTCTGGATAA
CATTGTGACCCAGAAAATGATGGCCG
TGCCGGATAGCTGGCCGTTTCATCAC
CCGGTGAACAAAAAATTTGTGCCGGA
TTATTATAAAGTGATTGTTAACCCGA
TGGATCTGGAAACCATTCGTAAAAAT
ATTAGCAAACACAAATATCAGAGCCG
CGAAAGCTTTCTGGATGATGTGAATC
TGATTCTGGCCAATAGCGTTAAATAT
AATGGTCCGGAAAGCCAGTATACCAA
AACCGCGCAGGAAATTGTGAACGTTT
GTTATCAGACCCTGACCGAATATGAT
GAACATCTGACCCAGCTGGAAAAAGA
TATCTGCACCGCCAAAGAAGCGGCGC
TGGAAGAAGCGGAACTGGAAAGCCTG
GATTGACAGTAAAGGTGGATACGGAT
CCGAA

Final protein sequence (Tag sequence in lowercase):
mhhhhhhssgvdlgtenlyfq^smQC
mhhhhhhssgvdlgtenlyfq^smSI
HRRRTDPMVTLSSILESIINDMRDLP
NTYPFHTPVNAKVVKDYYKIITRPMD
LQTLRENVRKRLYPSREEFREHLELI
VKNSATYNGPKHSLTQISQSMLDLCD
EKLKEKEDKLARLEKAINPLLDDDDQ
VAFSFILDNIVTQKMMAVPDSWPFHH
PVNKKFVPDYYKVIVNPMDLETIRKN
ISKHKYQSRESFLDDVNLILANSVKY
NGPESQYTKTAQEIVNVCYQTLTEYD
EHLTQLEKDICTAKEAALEEAELESL
D

^ TEV cleavage site

Tags and additions: Cleavable N-terminal His6 tag.

Host: BL21 (DE3)R3-pRARE2 (Phage resistant strain)

Growth medium, induction protocol: 10 ml from a 50 ml overnight culture containing 50 µg/ml kanamycin and 34 µg/ml chloramphenicol were used to inoculate each of two 1 liter cultures of TB containing 50 µg/ml kanamycin and 34 µg/ml chloramphenicol. Cultures were grown at 37°C until the OD₆₀₀ reached ~2.5 then the temperature was adjusted to 18°C. Expression was induced overnight using 0.1 mM IPTG at an OD₆₀₀ of 3.0. The cells were collected by centrifugation and the pellet re-suspended in binding buffer and frozen.
Binding buffer: 50 mM HEPES pH 7.5; 500 mM NaCl; 10 mM imidazole, 5% glycerol
Extraction buffer, extraction method: Frozen pellets were thawed and fresh 0.5 mM TCEP, 1 mM PMSF added to the lysate. Cells were lysed using sonication. DNA was precipitated with 0.15% PEI. The lysate was centrifuged at 17,000 rpm for 60 minutes and the supernatant collected for purification.

Column 1: Ni-affinity. Ni-sepharose (Amersham), 5 ml of 50% slurry in 1.5 x 10 cm column, washed with binding buffer

Column 1 Buffers:
Binding buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 5 mM imidazole, 5% glycerol
Wash buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 30 mM Imidazole, 5% glycerol
Elution buffer: 50 mM HEPES pH 7.5, 500 mM NaCl, 5% glycerol, 50 to 250 mM Imidazole (step elution).

Column 1 Procedure: The supernatant was loaded by gravity flow on the Ni-sepharose column. The column was washed first with 30 ml of binding buffer then with 30 ml of wash buffer at gravity flow. The protein was eluted by gravity flow by applying 5ml portions of elution buffer with increasing concentration of imidazole (50 mM, 100 mM, 150 mM, 200 and 250 mM); fractions were collected until essentially all protein was eluted

Enzymatic treatment: The N-terminal His tag was cleaved by treatment with TEV protease, overnight.

Column 2: Size Exclusion Chromatography; Superdex S75 16/60 HiLoad

Column 2 Buffers:
Buffer: 10 mM HEPES, pH 7.5; 500 mM NaCl, 5% glycerol

Column 2 Procedure: The protein was concentrated and applied to an S75 16/60 HiLoad gel filtration column equilibrated in 10 mM HEPES, pH 7.5; 500mM NaCl, 5% glycerol using an ÄKTAexpress system.

Protein concentration: The protein was concentrated to 20 mg/ml using an Amicon 3 kDa cut-off concentrator.

Mass spectrometry characterization:
Measured mass:: 30925.3 Da
LC-ESI-MS TOF gave a measured mass of 30925.3 Da for the TEV cleaved protein as predicted from the sequence of this protein.

Crystallisation: Protein buffer was exchanged to 10 mM HEPES pH7.5 and 300 mM NaCl. The protein was concentrated to 10 mg/ml using an Amicon 3 kDa cut-off concentrator.Crystals were grown at 4°C in 300 nl sitting drops from a 1:1 ratio of protein to reservoir solution containing 0.1M Tris.HCl pH 9.0, 1.1M (NH₄)₂SO₄

Data collection:
X-ray source: Diamond I02
Resolution: 0.97Å

Crystals were cryo-protected using the well solution supplemented by 2 M Li₂SO₄ and flash frozen in liquid nitrogen. Data were collected at Diamond beamline I02 at a wavelength of 0.97Å.

Phasing: The structure was solved by molecular replacement using an ensemble of known bromodomain structures as a starting model

References

Akai, Y., Adachi, N., Hayashi, Y., Eitoku, M., Sano, N., Natsume, R., Kudo, N., Tanokura, M., Senda, T., and Horikoshi, M. (2010). Structure of the histone chaperone CIA/ASF1-double bromodomain complex linking histone modifications and site-specific histone eviction. Proc Natl Acad Sci U S A 107, 8153-8158.
Allende-Vega, N., McKenzie, L., and Meek, D. (2008). Transcription factor TAFII250 phosphorylates the acidic domain of Mdm2 through recruitment of protein kinase CK2. Mol Cell Biochem 316, 99-106.
Allende-Vega, N., Saville, M.K., and Meek, D.W. (2007). Transcription factor TAFII250 promotes Mdm2-dependent turnover of p53. Oncogene 26, 4234-4242.
Jacobson, R.H., Ladurner, A.G., King, D.S., and Tjian, R. (2000). Structure and function of a human TAFII250 double bromodomain module. Science 288, 1422-1425.
Makino, S., Kaji, R., Ando, S., Tomizawa, M., Yasuno, K., Goto, S., Matsumoto, S., Tabuena, M.D., Maranon, E., Dantes, M., et al. (2007). Reduced neuron-specific expression of the TAF1 gene is associated with X-linked dystonia-parkinsonism. Am J Hum Genet 80, 393-406.
Tavassoli, P., Wafa, L.A., Cheng, H., Zoubeidi, A., Fazli, L., Gleave, M., Snoek, R., and Rennie, P.S. (2010). TAF1 differentially enhances androgen receptor transcriptional activity via its N-terminal kinase and ubiquitin-activating and -conjugating domains. Mol Endocrinol 24, 696-708.