Human glyoxalase domain-containing protein 5

Target ID:

GLOD5A

Deposition Date:

Thursday 28th July 2011

Families:

Oxidoreductases

Structure type:

apo

Download Coordinates:

3ZW5

Authors:

J.R.C.MUNIZ,W.KIYANI,S.Froese,M.VOLLMAR,F.VON DELFT,N.BURGESS-BROWN,C.H.ARROWSMITH,A.M.EDWARDS,J.WEIGELT,C.BOUNTRA,W.W.YUE

Site:

Oxford

ICM Datapack:

ICM Datapack

3ZW5

tabs

Structure Details

The glyoxalase domain is a βαβββ folding module found in the vicinal oxygen chelate (VOC) superfamily of proteins. Members in this superfamily catalyze a diverse set of biologically unrelated reactions, but share some common mechanistic features during enzyme catalysis [1]. To date, >13000 VOC sequences are annotated, and can be classified into different subclasses on the basis of the reaction types catalysed. These include isomerization (as exemplified by the founding member, glyoxalase, Glx1), epimerization (methylmalonyl-CoA epimerase, MCEE), C-C bond cleavage (non-heme, Fe(II)-dependent dioxygenases) and oxirane ring nucleophilic additions (fosfomycin resistance proteins, FRP) [2].

The above-mentioned reaction types, though chemically diverse, require a common and basic mechanistic imperative, in that an active site divalent metal is coordinated in a bidentate manner by the substrate or transition state intermediate through vicinal oxygen atoms. This requirement is mediated by a common architecture among the VOC enzymes to accommodate the metal ion. Structurally, two tandem βαβββ modules are assembled via a variety of topological arrangements (3), such that their eight β-strands form an incompletely closed barrel structure. Despite the low sequence homology among the proteins, conserved residues within the innermost β-strands provide metal-chelating side chains so that the substrate, intermediates or transition states can bind the metal. In the human genome, three glyoxalase domain-containing proteins have been biochemically and structurally characterized so far, namely glyoxalase I, MCEE, and hydroxyphenylpyruvate dioxygenase (HPPD). Here we present the structure of a recently-identified human member, the glyoxalase domain-containing protein 5 (GLOD5), where the glod5 gene is located at the chromosome position Xp11.23.

Materials and Methods

Entry Clone Source: Ordered-synthetic

Entry Clone Accession: Codon-optimized

SGC Construct ID: GLOD5A-c102

GenBank GI number: gi|122937414

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified construct sequence:
CATATGCACCATCATCATCATCATTC
TTCTGGTGTAGATCTGGGTACCGAGA
ACCTGTACTTCCAATCCATGCTGATT
CGTCGCCTGGATCATATCGTGATGAC
CGTTAAAAGCATCAAAGACACCACGA
TGTTCTACTCTAAAATCCTGGGCATG
GAAGTTATGACGTTCAAAGAAGATCG
TAAAGCCCTGTGTTTTGGCGACCAGA
AATTCAACCTGCATGAAGTTGGTAAA
GAATTTGAACCGAAAGCAGCACACCC
GGTCCCGGGCAGTCTGGATATTTGCC
TGATCACCGAAGTGCCGCTGGAAGAA
ATGATTCAACACCTGAAAGCATGTGA
CGTCCCGATCGAAGAAGGTCCGGTGC
CGCGTACGGGTGCTAAAGGTCCGATT
ATGAGCATTTATTTTCGTGACCCGGA
CCGTAACCTGATTGAAGTCTCTAACT
ACTGACAGTAAAGGTGGATACGGATC
CGAA

Final protein sequence (Tag sequence in lowercase):
mhhhhhhssgvdlgtenlyfq^smLI
RRLDHIVMTVKSIKDTTMFYSKILGM
EVMTFKEDRKALCFGDQKFNLHEVGK
EFEPKAAHPVPGSLDICLITEVPLEE
MIQHLKACDVPIEEGPVPRTGAKGPI
MSIYFRDPDRNLIEVSNY

^ TEV cleavage site

Tags and additions: Cleavable N-terminal His₆ tag.

Host: BL21 (DE3)R3-pRARE2 (Phage resistant strain).

Growth medium, induction protocol: The construct DNA was transformed into competent cells of the expression strain by a standard heat shock procedure. One colony from the transformation was used to inoculate 1ml of TB media containing 50µg/ml kanamycin and 34 µg/ml chloramphenicol, which was placed in a 37°C shaker overnight. The next day glycerol stocks were prepared from this overnight culture. A glycerol stock was used to inoculate 60ml of TB media containing 50µg/ml kanamycin and 34µg/ml chloramphenicol, which was placed in a 37°C shaker overnight. The next day this starter culture was used to inoculate 6L of TB media (9ml starter culture used per 1L) containing 50µg/ml kanamycin. When the OD₆₀₀ reached approximately 1.0 the temperature was reduced to 18°C and after a further 30 minutes the cells were induced by the addition of 0.1 mM IPTG. The expression was continued overnight. Cells were harvested by centrifugation at 6000 x g after which the supernatant was poured out and the cell pellet either placed in a -80°C freezer or used directly for purification.
Lysis buffer: 50 mM HEPES, pH 7.4; 500 mM NaCl; 10 mM Imidazole; 5% Glycerol; 0.5 mM TCEP; 1 tablet per 50ml protease inhibitor cocktail EDTA-free (Roche).
Extraction buffer, extraction method: Cell pellets were dissolved in approximately 200ml lysis buffer and broken by passing through the homogeniser (x6) at a constant pressure of 15KPa. The cell debris was pelleted at 16,000rpm and the supernatant used for further purification.

Column 1: Ni-NTA (5.0ml volume in a gravity-flow column).

Column 1 Buffers:
Binding buffer: 50 mM HEPES, pH 7.4; 500 mM NaCl; 5% glycerol; 10 mM Imidazole; 0.5 mM TCEP.
Wash buffer: 50 mM HEPES, pH 7.4; 500 mM NaCl; 5% glycerol; 40 mM Imidazole; 0.5 mM TCEP.
Elution buffer: 50 mM HEPES, pH 7.4; 500 mM NaCl; 5% glycerol; 250 mM Imidazole; 0.5 mM TCEP.

Column 1 Procedure: The clarified cell extract was incubated with 5.0ml of Ni-NTA pre-equilibrated with lysis buffer for 1 hour at 4°C with rotation after which it was passed through a glass column. The column was then washed with 50ml Binding Buffer (2 x 25ml) and 50ml Wash Buffer (2 x 25ml). The protein was eluted with 50ml of Elution Buffer in 5 x 5 ml fractions.

Column 2: Superdex S75 16/60 Gel Filtration.

GF Buffer: 10 mM HEPES, pH 7.4; 500 mM NaCl; 5% glycerol; 0.5 mM TCEP.

Column 2 Procedure: Elution fraction from Ni-NTA column (5ml) was applied directly to the GF column (pre-equilibrated in GF Buffer) at 1.0ml/min. 1.0ml fractions were collected.

Enzymatic treatment: The N-terminal His tag was cleaved by treatment with TEV protease, overnight.

Column 3: 1ml Resource Q Cation Exchange

Column 3 Buffers:
Buffer A : 50 mM HEPES, pH 7.5; 50 mM NaCl.
Buffer B : 50 mM HEPES, pH 7.5; 2 M NaCl.

Column 3 Procedure: Pooled fractions giving a total approximate volume of 12ml were then diluted to 100 ml using Buffer A and injected into a 1ml Resource S column. Protein was eluted using a linear gradient of 0-100% Buffer B over 35 column volumes at 1ml/min. 1.0ml fractions were collected.

Protein concentration: Fractions containing protein were pooled and concentrated to 14mg/ml using a 10kDa mwco concentrator.

Mass spectrometry characterization: After TEV protease digestion:
Measured mass: 16434.5Da
Expected mass: 16817.5Da

Crystallisation: Crystals were grown by vapour diffusion in sitting drop at 20°C. A sitting drop consisting of 100nl protein and 50nl well solution was equilibrated against well solution containing 2 M ammonium sulfate, 20% (w/v) PEG400 and 0.1 M HEPES, pH 7.0. Crystals were mounted in the presence of 20% (v/v) PEG400 and flash-cooled in liquid nitrogen.

Data collection:
Resolution: 1.50Å.
X-ray source: Diamond Light Source beamline I03.

References

Gerlt JA, Babbitt PC. (2001). Divergent evolution of enzymatic function: mechanistically diverse superfamilies and functionally distinct suprafamilies. Annu Rev Biochem 70:209-46
Armstrong RN. (2000). Mechanistic diversity in a metalloenzyme superfamily. Biochemistry 39:13625-32
He P, Moran GR. (2011). Structural and mechanistic comparisons of the metal-binding members of the vicinal oxygen chelate (VOC) superfamily. J Inorg Biochem 105:1259-1272