Human tandem VHS and FYVE domains of Hepatocyte growth factor-regulated tyrosine kinase substrate

Target ID:

HGSA

Deposition Date:

Wednesday 24th August 2011

Families:

Miscellaneous

Structure type:

apo

Download Coordinates:

3ZYQ

Authors:

J.R.C.Muniz,V.Ayinampudi,L.Shrestha,T.Krojer,M.Vollmar,F.von Delft,C.H.Arrowsmith,A.M.Edwards,J.Weigelt,C.Bountra,A.Bullock

Site:

Oxford

3ZYQ

tabs

Structure Details

Hepatocyte growth factor-regulated tyrosine kinase substrate (HGS/Hrs) is conserved from mammals to yeast (Vps27) and together with STAM is a component of the ESCRT-0 protein complex that captures ubiquitylated receptor proteins and sorts them to the lysosomal pathway. Mice lacking Hrs die early in embryonic development and have abnormally enlarged endosomes, suggestive of defects in sorting. Cellular knock down of Hrs attenuated tumour cell growth and metastasis. The Endosomal Sorting Complexes Required for Transport (ESCRT) machinery is also required for the final stages of assembly of a number of viruses. Knock down of Hrs increases cellular levels of BST-2/tetherin and restricts HIV-1 release. Hrs is also linked to the ubiquitin-independent endosomal sorting of interleukin-2 receptor β (IL-2Rβ).

Hrs contains VHS, FYVE, ubiquitin interaction motif (UIM) and GAT domains as well as a clathrin binding domain. The FYVE domain binds PtdIns3P (PI3P) and localizes Hrs to endosomes, whereas the GAT domain mediates assembly with STAM. Other domains, including the VHS and UIM domains, present multiple sites for protein capture. We solved the high resolution structure of the tandem VHS and FYVE domains of human Hrs refined at 1.5 Å resolution.

Materials and Methods

Entry Clone Source: MGC

Entry Clone Accession: BC003565

SGC Construct ID: HGSA-c001

GenBank GI number: gi|4758528

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified construct sequence:
TACTTCCAATCCATGGGGCGAGGCAG
CGGCACCTTCGAGCGTCTCCTAGACA
AGGCGACCAGCCAGCTCCTGTTGGAG
ACAGATTGGGAGTCCATTTTGCAGAT
CTGCGACCTGATCCGCCAAGGGGACA
CACAAGCAAAATATGCTGTGAATTCC
ATCAAGAAGAAAGTCAACGACAAGAA
CCCACACGTCGCCTTGTATGCCCTGG
AGGTCATGGAATCTGTGGTAAAGAAC
TGTGGCCAGACAGTTCATGATGAGGT
GGCCAACAAGCAGACCATGGAGGAGC
TGAAGGACCTGCTGAAGAGACAAGTG
GAGGTAAACGTCCGTAACAAGATCCT
GTACCTGATCCAGGCCTGGGCGCATG
CCTTCCGGAACGAGCCCAAGTACAAG
GTGGTCCAGGACACCTACCAGATCAT
GAAGGTGGAGGGGCACGTCTTTCCAG
AATTCAAAGAGAGCGATGCCATGTTT
GCTGCCGAGAGAGCCCCAGACTGGGT
GGACGCTGAGGAATGCCACCGCTGCA
GGGTGCAGTTCGGGGTGATGACCCGT
AAGCACCACTGCCGGGCGTGTGGGCA
GATATTCTGTGGAAAGTGTTCTTCCA
AGTACTCCACCATCCCCAAGTTTGGC
ATCGAGAAGGAGGTGCGCGTGTGTGA
GCCCTGCTACGAGCAGCTGAACAGGA
AAGCGGAGGGATGACAGTAAAGGTGG
ATA

Final protein sequence (Tag sequence in lowercase):
mhhhhhhssgvdlgtenlyfq^smGR
GSGTFERLLDKATSQLLLETDWESIL
QICDLIRQGDTQAKYAVNSIKKKVND
KNPHVALYALEVMESVVKNCGQTVHD
EVANKQTMEELKDLLKRQVEVNVRNK
ILYLIQAWAHAFRNEPKYKVVQDTYQ
IMKVEGHVFPEFKESDAMFAAERAPD
WVDAEECHRCRVQFGVMTRKHHCRAC
GQIFCGKCSSKYSTIPKFGIEKEVRV
CEPCYEQLNRKAEG

^ TEV cleavage site

Tags and additions: Cleavable N-terminal His₆ tag.

Host: BL21 (DE3)R3-pRARE2 (Phage resistant strain).

Growth medium, induction protocol: A glycerol stock was used to inoculate a 10ml starter culture containing LB media with 50µg/ml Kanamycin and 34µg/ml Chloramphenicol. The starter culture was grown overnight at 37°C with shaking at 200 rpm. The following morning, three flasks containing 1L LB/Kanamycin were each inoculated with 1 ml of the starter culture. Cultures were incubated at 37°C with shaking at 180 rpm until an OD₆₀₀nm = 0.4 was reached. The flasks were then cooled down to 18°C to an OD₆₀₀nm = 0.7 and added 0.4mM IPTG to induce protein expression overnight. Cells were harvested by centrifugation at 4500 rpm at 4°C for 15 min. Cell pellets from each flask were resuspended in 25ml Binding buffer (50mM HEPES, pH 7.5; 500mM NaCl; 5% Glycerol; 5mM Imidazole).
Extraction buffer, extraction method: The cells were lysed by ultrasonication over 7 min with the sonicator pulsing ON for 5 sec and OFF for 10 sec. The cell lysate was spun down by centrifugation at 18000 rpm at 4°C for 1 h. The supernatant was recovered for purification.

Column 1: Ni-Affinity Chromatography twinned with DE-52 column

Column 1 Buffers:
Binding buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% glycerol; 5 mM Imidazole.
Wash buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% glycerol; 30 mM Imidazole.
Elution buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% glycerol, 50 to 250 mM Imidazole (step elution).

Column 1 Procedure: 2.5g of DE-52 resin dissolved in 25ml 2.5M NaCl was applied onto a drip column and equilibrated with Binding buffer. 5ml of 50 % Ni-IDA slurry () was applied onto a 1.5 x 10 cm column. The column was first washed with deionised distilled H₂O, and then equilibrated with Binding buffer. DE-52 column was mounted on top of the Ni column. The supernatant was applied by gravity flow onto the DE-52 column and then passed onto the Ni column. The Ni column was washed with Wash buffer and the bound protein was eluted by applying a step gradient of Imidazole (5 ml fractions of Elution buffer supplemented with 50mM, 100mM, 150mM and 2x10ml fractions with 250mM Imidazole). 10mM Arginine/Glutamic Acid was added to each fraction collected for overnight storage at 4°C.

Enzymatic treatment:TEV protease cleavage. Fractions containing HGS were treated with TEV protease overnight at 4°C.

Column 2: Ni-Affinity Chromatography

Column 2 Buffers:
Binding buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% glycerol; 5 mM Imidazole.
Wash buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% glycerol; 30 mM Imidazole.
Elution buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% glycerol, 250 mM Imidazole (step elution).

Column 2 Procedure: 500µl of 50 % Ni-IDA slurry was applied onto a BioRad Poly-Prep disposable drip column. The column was first washed with deionised distilled H₂O, and then equilibrated with Binding buffer. The HGS pool treated with TEV was applied by gravity flow onto the Ni-IDA column. The flow through was collected, washed the column with 10ml Wash buffer and the bound impurities were eluted with 500µl of elution buffer with 250mM Imidazole.

Column 3: Size Exclusion Chromatography. Superdex S200 16/60 HiLoad (GE Healthcare).

Column 3 Buffer: 50 mM HEPES, pH 7.5; 300 mM NaCl; 0.5 mM TCEP.

Column 3 Procedure: The Superdex S200 column was first equilibrated with Gel Filtration buffer. Concentrated the protein fraction from above step to

Column 4: Ni-Affinity Chromatography

Column 4 Buffers:
Binding buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% glycerol; 5 mM Imidazole.
Wash buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% glycerol; 30 mM Imidazole.
Elution buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% glycerol, 250 mM Imidazole.

Column 4 Procedure: 500µl of 50 % Ni-IDA slurry was applied onto a BioRad Poly-Prep disposable drip column. The column was first washed with deionised distilled H₂O, and then equilibrated with Binding buffer. Protein from Gel Filtration step was applied by gravity flow onto the Ni-IDA column. The flow through was collected, washed the column with 10ml Wash buffer and the bound impurities were eluted with 500µl of elution buffer with 250mM Imidazole. Added 10mM DTT and 10mM Arginine/Glutamic Acid to the flow through.

Column 5: Cation Exchange Chromatography - HiTrap SP HP column

Column 5 Buffers:
IEX Buffer I: 50mM HEPES pH 7.5
IEX Buffer II: 1M NaCl, 50mM HEPES pH 7.5

Column 5 Procedure: The HiTrap SP HP column was first washed with IEX buffer II and then equilibrated with IEX buffer I. Concentrated the protein fraction from above step to 5ml using an Amicon Ultra-15 filter with a 10kDa cut-off. The 5ml fraction was made up to 50ml with IEX buffer I and applied onto the column using a super loop. Bound protein was eluted in 0%-100% gradient with IEX buffer II. Clean fractions containing the protein were pooled together.

Protein concentration: The protein was concentrated in an Amicon Ultra-4 filter with a 10 kDa cut-off.

Mass spectrometry characterization: Pending analysis

Crystallisation: Protein was buffered in 40mM NaCl, 50mM HEPES pH 7.5, 10mM DTT and 10mM Arginine/Glutamic acid. Protein was concentrated to 11.7 mg/ml (calculated using extinction co-efficient of 26930). Native crystals were grown at 20°C in 150nl sitting drops mixing 50nl protein solution with 100nl of a reservoir solution containing 25% PEG 3350, 0.1M NH₄SO₄, 0.1M Bis-Tris pH 7.0. On mounting crystals were cryo-protected with an additional 25% Ethylene glycol.

Data collection:
X-ray source: Diamond I04 (native)
Resolution: 1.5Å

References

Janvier K, Pelchen-Matthews A, Renaud JB, Caillet M, Marsh M, Berlioz-Torrent C. (2011). The ESCRT-0 component HRS is required for HIV-1 Vpu-mediated BST-2/tetherin down-regulation. PLoS Pathog. 7, e1001265.
Ren X, Kloer DP, Kim YC, Ghirlando R, Saidi LF, Hummer G, Hurley JH. (2009). Hybrid structural model of the complete human ESCRT-0 complex. Structure. 17, 406-16.
Toyoshima M, Tanaka N, Aoki J, Tanaka Y, Murata K, Kyuuma M, Kobayashi H, Ishii N, Yaegashi N, Sugamura K. (2007). Inhibition of tumor growth and metastasis by depletion of vesicular sorting protein Hrs: its regulatory role on E-cadherin and beta-catenin. Cancer Res. 67, 5162-71.
Stern KA, Visser Smit GD, Place TL, Winistorfer S, Piper RC, Lill NL. (2007). Epidermal growth factor receptor fate is controlled by Hrs tyrosine phosphorylation sites that regulate Hrs degradation. Mol Cell Biol. 27, 888-98.
Pullan L, Mullapudi S, Huang Z, Baldwin PR, Chin C, Sun W, Tsujimoto S, Kolodziej SJ, Stoops JK, Lee JC, Waxham MN, Bean AJ, Penczek PA. (2006). The endosome-associated protein Hrs is hexameric and controls cargo sorting as a "master molecule". Structure. 14, 661-71.
Hirano S, Kawasaki M, Ura H, Kato R, Raiborg C, Stenmark H, Wakatsuki S. (2006). Double-sided ubiquitin binding of Hrs-UIM in endosomal protein sorting. Nat Struct Mol Biol. 13, 272-7.
Hanyaloglu AC, McCullagh E, von Zastrow M. (2005). Essential role of Hrs in a recycling mechanism mediating functional resensitization of cell signaling. EMBO J. 24, 2265-83.
Kobayashi H, Tanaka N, Asao H, Miura S, Kyuuma M, Semura K, Ishii N, Sugamura K. (2005). Hrs, a mammalian master molecule in vesicular transport and protein sorting, suppresses the degradation of ESCRT proteins signal transducing adaptor molecule 1 and 2. J Biol Chem. 280, 10468-77.
Lloyd TE, Atkinson R, Wu MN, Zhou Y, Pennetta G, Bellen HJ. (2002). Hrs regulates endosome membrane invagination and tyrosine kinase receptor signaling in Drosophila. Cell. 108, 261-9.
Mao Y, Nickitenko A, Duan X, Lloyd TE, Wu MN, Bellen H, Quiocho FA. (2000). Crystal structure of the VHS and FYVE tandem domains of Hrs, a protein involved in
membrane trafficking and signal transduction. Cell. 100, 447-56.