Human p73-ASPP2 complex at 2.6 Ã… resolution

Target ID:

XX01TP73A

Deposition Date:

Monday 31st October 2011

Families:

Miscellaneous

Structure type:

protein-protein

Download Coordinates:

4A63

Authors:

P.Canning, T.Sharpe, T.Krojer, P.Savitsky, C.D.O.Cooper, E.Salah, T.Keates, J.Muniz, M.Vollmar, F.Von Delft, J.Weigelt, C.Arrowsmith, C.Bountra, A.Edwards, A.Bullock

Site:

Oxford

4A63

tabs

Structure Details

p73 belongs with p53 and p63 to the p53 family of transcription factors [1]. The three family members exhibit high sequence identity among their transactivation, DNA binding, and tetramerization domains and regulate an overlapping but non-redundant set of target promoters. Two different promoters in the p73 gene give rise to DeltaN or TA isoforms either lacking or containing an N-terminal transactivation domain, respectively. In addition, alternative splicing produces different C-termini, resulting in 29 different splice forms. Extended C-terminal isoforms of both p63 and p73 contain a SAM domain that is absent in p53. Depending on their domain composition, the different isoforms can act either as transcriptional activators or repressors. Isoforms harbouring the transactivation domain mostly suppress cell growth, while those lacking the domain promote it [2].

ASPP2 (apoptosis stimulating p53 protein 2) was originally identified as 53BP2 [3] and binds the p53 DNA binding domain through its ankyrin repeat and SH3 domains [4]. 53BP2 was later revealed to be the C-terminal region of the larger ASPP2, which specifically upregulates the pro-apoptotic function of p53 [5]. ASPP2 shares many characteristics with family members ASPP1 and iASPP, of which ASPP1 is also an activator of p53 activity, whereas iASPP is an inhibitor [6]. Studies have shown that ASPP2 can also associate with p63 and p73 [7] and thereby induce apoptosis independently of p53 [8].

Here we determined the structure of the p73-ASPP2 complex refined at 2.6 Å resolution.

Materials and Methods

TP73A: P73 / Tumour Protein 73 Materials & Methods

Entry Clone Source: NIH Mammalian Gene Collection

Entry Clone Accession: BC117251

SGC Construct ID: TP73A-c009

GenBank GI number:

Vector: pNIC-CTHF. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified construct sequence:
TTAAGAAGGAGATATACTATGGCGCC
TGTCATCCCCTCCAACACCGACTACC
CCGGACCCCACCACTTTGAGGTCACT
TTCCAGCAGTCCAGCACGGCCAAGTC
AGCCACCTGGACGTACTCCCCGCTCT
TGAAGAAACTCTACTGCCAGATCGCC
AAGACATGCCCCATCCAGATCAAGGT
GTCCACCCCGCCACCCCCAGGCACTG
CCATCCGGGCCATGCCTGTTTACAAG
AAAGCGGAGCACGTGACCGACGTCGT
GAAACGCTGCCCCAACCACGAGCTCG
GGAGGGACTTCAACGAAGGACAGTCT
GCTCCAGCCAGCCACCTCATCCGCGT
GGAAGGCAATAATCTCTCGCAGTATG
TGGATGACCCTGTCACCGGCAGGCAG
AGCGTCGTGGTGCCCTATGAGCCACC
ACAGGTGGGGACGGAATTCACCACCA
TCCTGTACAACTTCATGTGTAACAGC
AGCTGTGTAGGGGGCATGAACCGGCG
GCCCATCCTCATCATCATCACCCTGG
AGATGCGGGATGGGCAGGTGCTGGGC
CGCCGGTCCTTTGAGGGCCGCATCTG
CGCCTGTCCTGGCCGCGACCGAAAAG
CTGATGAGGACCACTACCGGGAGGCA
GAGAACCTCTACTTCCAATC

Final protein sequence (Tag sequence in lowercase):
MAPVIPSNTDYPGPHHFEVTFQQSST
AKSATWTYSPLLKKLYCQIAKTCPIQ
IKVSTPPPPGTAIRAMPVYKKAEHVT
DVVKRCPNHELGRDFNEGQSAPASHL
IRVEGNNLSQYVDDPVTGRQSVVVPY
EPPQVGTEFTTILYNFMCNSSCVGGM
NRRPILIIITLEMRDGQVLGRRSFEG
RICACPGRDRKADEDHYREaenlyfq
^shhhhhhdykddddk

^ TEV cleavage site

Tags and additions: TEV-cleavable C-terminal hexahistidine and FLAG tag

Host: BL21(DE3)-R3-pRARE2

Growth Medium & Expression: A glycerol stock was used to inoculate a 10ml starter culture containing LB media with 50µg/ml Kanamycin and 34 µg/ml chloramphenicol. The starter culture was grown overnight at 37°C with shaking at 200 rpm. The following morning, two flasks containing 1 L LB/kanamycin/chloramphenicol were each inoculated with 5 ml of the starter culture. Cultures were incubated at 37°C with shaking at 180 rpm until an OD₆₀₀nm â¥ 0.6 was reached. The flasks were then cooled down to 18°C. Protein expression was induced by addition of IPTG to a final concentration of 0.2mM and expression carried out overnight.

Cell harvest: Cells were harvested by centrifugation at 6000 rpm at 4°C for 15 min.

Cell Lysis: Cell pellets from each flask were resuspended in 30ml binding buffer (50mM HEPES, pH 7.5; 500mM NaCl; 5% Glycerol; 5mM Imidazole), transferred to 50 ml tubes, and stored at -20°C.
Lysis buffer: 50 mM Hepes pH 7.4, 500 mM NaCl, 5% Glycerol, 10 mM Imidazole pH 7.4, 0.5 mM TCEP, 1 tablet per 50 ml protease inhibitor cocktail EDTA-free (Roche)
Extraction buffer, extraction method: The frozen cells were thawed and 0.5mM TCEP, 1mM PMSF added to the cell suspension. The cells were lysed by ultrasonication over 12 min with the sonicator pulsing ON for 4 sec and OFF for 8 sec. The cell lysate was spun down by centrifugation at 20000 rpm at 4°C for 1 h. The supernatant was recovered for purification.

Column 1: Anion-exchange for Nucleic acid removal with DEAE cellulose (DE52, Whatmann).

10 g of resin was suspended in 100 ml 2.5 M NaCl, and then applied onto a 2.5 x 20 cm column. The resin was then equilibrated with 100 ml binding buffer prior to loading the sample.

Column 1 Buffers:
Binding buffer: 50mM HEPES, pH 7.5; 500mM NaCl; 5% Glycerol; 5mM Imidazole
Wash buffer: 50mM HEPES, pH 7.5; 500mM NaCl; 5% Glycerol; 30mM Imidazole

Column 1 Procedure: The supernatant was first applied onto the column by gravity flow, which was followed by a wash with 100 ml wash buffer. The column flow-through and wash was directly applied onto the following Ni-sepharose column

Column 2: Ni-Affinity Chromatography

5ml of 50 % Ni-sepharose slurry (Amersham) was applied onto a 1.5 x 10 cm column. The column was first washed with deionised distilled H₂O, and then equilibrated with binding buffer.

Column 2 Buffers:
Binding buffer: 50mM HEPES, pH 7.5; 500mM NaCl; 5% Glycerol; 5mM Imidazole
Wash buffer: 50mM HEPES, pH 7.5; 500mM NaCl; 5% Glycerol; 30mM Imidazole
Elution buffer: 50mM HEPES, pH 7.5; 500mM NaCl; 5% Glycerol; 50 to 250mM Imidazole

Column 2 Procedure: The supernatant was applied by gravity flow onto the Ni-sepharose column. The column was washed with wash buffer to remove nonspecifically binding proteins. The bound target protein was eluted by applying a step gradient of imidazole (5 ml fractions of elution buffer supplemented with 50mM, 100mM, 150mM and 250mM imidazole). The protein content of collected fractions was visualized using SDS-PAGE and fractions containing sufficient TP73A (relative to contaminating proteins) were pooled. 10mM DTT was added to the pooled fractions for overnight storage at 4°C.

Enzymatic Treatment:TEV protease cleavage. Pooled fractions were treated with TEV protease overnight at 4°C.

Column 3: Size Exclusion Chromatography S200 HiLoad 16/60 Superdex run on &Aumlaut;KTA-Express.

Column 3 Buffers:
Gel filtration buffer: 300mM NaCl, 50mM HEPES pH 7.5, 0.5mM TCEP.

Column 3 Procedure: Prior to applying the protein, the S200 16/60 column was washed and equilibrated with gel filtration buffer. Eluted protein from the Ni-sepharose column was cleaved with TEV protease and concentrated to 1ml using an Amicon Ultra-15 filter with a 10kDa cut-off. The concentrated protein was directly applied onto the equilibrated S200 16/60 column, and run at a flow-rate of 1 ml/min. Fractions were visualized using SDS-PAGE and those containing TP73A were pooled.

Mass spectrometry characterization:
Observed mass: 23184.05 Da
Expected mass: 23313.6 Da

Mass spec procedure: The purified native protein was homogeneous and had an experimental mass after tag cleavage of 23184.05 consistent with loss of the N-terminal initiator methionine (calculated MW of this species = 23313.6). Masses were determined by LC-MS, using an Agilent LC/MSD TOF system with reversed-phase HPLC coupled to electrospray ionisation and an orthogonal time-of-flight mass analyser.

ASPP2 / Apoptosis Stimulating p53 Protein 2 (aka TP53BP2A: Tumour Protein 53 Binding Protein 2) Materials & Methods

Entry Clone Source: NIH Mammalian Gene Collection

Entry Clone Accession: BC040247

SGC Construct ID: TP53BP2A-c003

GenBank GI number:

Vector: pCOEX-LIC1 Details [PDF ]; Sequence [ FASTA ]

Amplified construct sequence:
GAACGAAGTTCGCTTCTTCCTTCGTC
TACTTCCAATCCATGCCTGAAATCAC
CGGGCAGGTCTCTCTGCCTCCTGGTA
AAAGGACAAACTTGCGTAAAACTGGC
TCAGAGCGTATCGCTCATGGAATGAG
GGTGAAATTCAACCCCCTTGCTTTAC
TGCTAGATTCGTCTTTGGAGGGAGAA
TTTGACCTTGTACAGAGAATTATTTA
TGAGGTTGATGACCCAAGCCTCCCCA
ATGATGAAGGCATCACGGCTCTTCAC
AATGCTGTGTGTGCAGGCCACACAGA
AATCGTTAAGTTCCTGGTACAGTTTG
GTGTAAATGTAAATGCTGCTGATAGT
GATGGATGGACTCCATTACATTGTGC
TGCCTCATGTAACAACGTCCAAGTGT
GTAAGTTTTTGGTGGAGTCAGGAGCC
GCTGTGTTTGCCATGACCTACAGTGA
CATGCAGACTGCTGCAGATAAGTGCG
AGGAAATGGAGGAAGGCTACACTCAG
TGCTCCCAATTTCTTTATGGAGTTCA
GGAGAAGATGGGCATAATGAATAAAG
GAGTCATTTATGCGCTTTGGGATTAT
GAACCTCAGAATGATGATGAGCTGCC
CATGAAAGAAGGAGACTGCATGACAA
TCATCCACAGGGAAGACGAAGATGAA
ATCGAATGGTGGTGGGCGCGCCTTAA
TGATAAGGAGGGATATGTTCCACGTA
ACTTGCTGGGACTGTACCCAAGAATT
AAACCAAGACAAAGGAGCTTGGCCTG
ACAGTAAAGGTGGATA

Final protein sequence (Tag sequence in lowercase):
mhhhhhhssgvdlgtenlyfq^smpE
ITGQVSLPPGKRTNLRKTGSERIAHG
MRVKFNPLALLLDSSLEGEFDLVQRI
IYEVDDPSLPNDEGITALHNAVCAGH
TEIVKFLVQFGVNVNAADSDGWTPLH
CAASCNNVQVCKFLVESGAAVFAMTY
SDMQTAADKCEEMEEGYTQCSQFLYG
VQEKMGIMNKGVIYALWDYEPQNDDE
LPMKEGDCMTIIHREDEDEIEWWWAR
LNDKEGYVPRNLLGLYPRIKPRQRSL
A

^ TEV cleavage site

Tags and additions: TEV-cleavable N-terminal His7 tag.

Host: BL21(DE3)-R3-pRARE2

Growth Medium & Expression: A glycerol stock was used to inoculate a 10ml starter culture containing LB media with 34 µg/ml chloramphenicol. The starter culture was grown overnight at 37°C with shaking at 200 rpm. The following morning, six flasks containing 1 L LB/chloramphenicol were each inoculated with 5 ml of the starter culture. Cultures were incubated at 37°C with shaking at 180 rpm until an OD₆₀₀nm â¥ 0.6 was reached. The flasks were then cooled down to 18°C. Protein expression was induced by addition of IPTG to a final concentration of 0.2mM and expression carried out overnight.

Cell harvest: Cells were harvested by centrifugation at 6000 rpm at 4°C for 15 min.

Cell Lysis: Cell pellets from each flask were resuspended in 30ml binding buffer (50mM HEPES, pH 7.5; 500mM NaCl; 5% Glycerol; 5mM Imidazole), transferred to 50 ml tubes, and stored at -20°C.
Extraction buffer, extraction method: The frozen cells were thawed and 0.5mM TCEP, 1mM PMSF added to the cell suspension. The cells were lysed using an Emulsiflex C3 homogeniser. The cell lysate was clarified by centrifugation at 20000 rpm at 4°C for 1 h. The supernatant was recovered for purification and filtered through a syringe filter with 1.2Î¼m pore size.

Column 1: Ni-Affinity Chromatography 2ml Ni-sepharose slurry applied to a 1.5 x 10 cm column

Column 1 Buffers:
Binding buffer: 50mM HEPES, pH 7.5; 500mM NaCl; 5% Glycerol; 5mM Imidazole
Wash buffer: 50mM HEPES, pH 7.5; 500mM NaCl; 5% Glycerol; 30mM Imidazole
Elution buffer: 50mM HEPES, pH 7.5; 500mM NaCl; 5% Glycerol; 50 to 250mM Imidazole

Enzymatic Treatment:TEV protease cleavage. Pooled fractions were treated with TEV protease overnight at 4°C.

Column 2: Ion Exchange Chromatography HiTrap Q HP 5ml run on Akta Express

Column 2 Buffers:
Buffer A: 50mM HEPES, pH 7.5; 50mM NaCl; 0.5mM TCEP
Buffer B: 50mM HEPES, pH 7.5; 1M NaCl; 0.5mM TCEP
Sample buffer: 50mM HEPES, pH 7.5; 0.5mM TCEP

Column 2 Procedure: Prior to applying the protein, the HiTrap Q HP 5ml column was washed with buffer B and equilibrated in buffer A. Eluted protein from the Ni-sepharose column was cleaved with TEV protease and diluted in sample buffer 10x to give a final buffer concentration of 50mM NaCl. The diluted protein was applied onto the equilibrated HiTrap Q column and the column washed with 4 column volumes of buffer A. Bound proteins were eluted with a gradient up to 50% buffer B over 100ml at 4 ml/minute and 1ml fractions were collected by peak detection. Fractions were visualized using SDS-PAGE and those containing ASPP2 were pooled.

Column 3: Size Exclusion Chromatography S75 HiLoad 16/60 Superdex run on &Aumlaut;KTA-Express.

Column 3 Buffers:
Gel filtration buffer: 10mM HEPES pH 7.5, 150mM NaCl, 0.5mM TCEP

Column 3 Procedure: Prior to applying the protein, the S75 16/60 column was washed and equilibrated with gel filtration buffer. Eluted protein from the HiTrap Q HP column was concentrated to 1ml using an Amicon Ultra-15 filter with a 10kDa cut-off. The concentrated protein was directly applied onto the equilibrated S75 16/60 column, and run at a flow-rate of 1 ml/min. Fractions were visualized using SDS-PAGE and those containing ASPP2 were pooled.

Mass spectrometry characterization:
Observed mass: 26924.43 Da
Expected mass: 26924.6 Da

Mass spec procedure: The purified native protein was homogeneous and had an experimental mass after tag cleavage of 26924.43 consistent with the calculated intact mass (calculated MW of this species = 26924.6). Masses were determined by LC-MS, using an Agilent LC/MSD TOF system with reversed-phase HPLC coupled to electrospray ionisation and an orthogonal time-of-flight mass analyser.

Complex materials & methods

Concentration and complex formation: The two proteins were mixed in a 1:1 ratio, then buffer exchanged (into 10mM HEPES pH 7.5, 0.5mM TCEP) and concentrated to a final concentration of 11mg/ml (measured by OD₂₈₀ based on extinction coefficient 58330) in an Amicon Ultra-15 filter with a 10 kDa cut-off.

Crystallisation: The complete complex at 11mg/ml was buffered in 10mM HEPES, pH 7.5, 0.5 mM TCEP. Crystals were grown at 4°C in 150 nl sitting drops mixing 100 nl protein solution with 50 nl of a reservoir solution containing 1.0M sodium potassium phosphate and 0.1M acetate pH 4.5. On mounting crystals were cryo-protected with an additional 20% ethylene glycol.

Data collection:
Resolution: 2.6Å.
X-ray source: Diamond Light Source beamline I03.

Crystals of TP73A diffracted to a resolution of 2.6 Å (scaled resolution). A full dataset was collected at 100 K on Diamond Light Source beamline I03. Crystals belonged to the space group I121 with unit-cell parameters a= 132.8 Å b= 170.1 Å c= 177.6 Å, α=90° β= 92° γ= 90°. Six complete complexes (12 chains in total) were present in the asymmetric unit. Data were indexed and integrated using iMOSFLM and scaled using SCALA. Phases were found using molecular replacement in PHASER using PDB entries 1YCS (chain B) and 2XWC as search models. The structure was initially refined and modified using alternate rounds of REFMAC5 and COOT, and completed using BUSTER

References

Stiewe, T., The p53 family in differentiation and tumorigenesis. Nat Rev Cancer, 2007. 7(3): p. 165-8.
Zawacka-Pankau, J., et al., p73 tumor suppressor protein: a close relative of p53 not only in structure but also in anti-cancer approach? Cell Cycle, 2010. 9(4): p. 720-8.
Iwabuchi, K., et al., Two cellular proteins that bind to wild-type but not mutant p53. Proc Natl Acad Sci U S A, 1994. 91(13): p. 6098-102.
Gorina, S. and N.P. Pavletich, Structure of the p53 tumor suppressor bound to the ankyrin and SH3 domains of 53BP2. Science, 1996. 274(5289): p. 1001-5.
Samuels-Lev, Y., et al., ASPP proteins specifically stimulate the apoptotic function of p53. Mol Cell, 2001. 8(4): p. 781-94.
Bergamaschi, D., et al., iASPP oncoprotein is a key inhibitor of p53 conserved from worm to human. Nat Genet, 2003. 33(2): p. 162-7.
Robinson, R.A., et al., Biochemical and structural studies of ASPP proteins reveal differential binding to p53, p63, and p73. Structure, 2008. 16(2): p. 259-68.
Bergamaschi, D., et al., ASPP1 and ASPP2: common activators of p53 family members. Mol Cell Biol, 2004. 24(3): p. 1341-50.