Human P63 Tetramerization 2 domain

Target ID:

TP73LA

Deposition Date:

Wednesday 30th November 2011

Families:

Miscellaneous

Related Diseases:

CancerSignallingNeurobiology

Structure type:

apo

Download Coordinates:

4A9Z

Authors:

J.R.C.MUNIZ,D.COUTANDIN,E.SALAH,A.CHAIKUAD,M.VOLLMAR,J.WEIGELT,C.H.ARROWSMITH,A.M.EDWARDS,C.BOUNTRA,V.DOTSCH,F.VON DELFT,S.KNAPP

Site:

Oxford

4A9Z

tabs

Structure Details

Human p63 Tetramerization Domain (TD)

PDB code: 4A9Z

p63 (TP63; TP73L, Tumor protein p73-like) belongs with p53 and p73 to the p53 family of proteins. All p53 family members exhibit high amino acid identity, especially among their transactivation (TAD), DNA-binding (DBD), and tetramerization domain (TD). Two different promoters in the p63 gene give rise to isoforms either containing an N-terminal transactivation domain (TA) or lacking this domain (DeltaN). In addition, alternative splicing produces several C-terminal splice variants. Whereas the isoforms with the shortest C termini (TAp63γ,δ,ε and TAp73γ,δ) show a very similar domain organization compared to p53, the isoforms with the extended C-termini (TAp63α and TAp73α) contain additional domains that are not present in p53, namely a sterile alpha motif (SAM) domain and a transcription inhibition domain (TID). The different isoforms can act as transcriptional activators or repressors depending of the isoform. p63 is thereby able to utilize p53 DNA binding sites but unique p63 consensus recognition sites have also been identified.

Knockout studies have shown that p63 plays a key role in the development of limbs, epithelial cells and cranium as those mice display severe deformations of limbs as well as of epithelia including skin, breast, urothelia, and prostate. p63-/- mice lack mammary glands, hair follicles, and teeth. Due to the slightly different phenotypes of the knockout models created it is under discussion if p63 is required for stem cell maintenance or commitment to stratification. Likewise the role of p63 in tumour formation is still unclear as in one p63+/- model mice developed spontaneous tumours whereas in the other they did not. Likewise p63 has been found to be over-expressed in a number of tumours but also been found to be reduced in others implicating that it has the potential to function as a tumour suppressor or as a proto-oncogene. Additionally p63 plays in conjunction with p73 a role in apoptosis and is essential in a process of DNA damage-induced oocyte death.

Mutations in p63 can lead to a variety of human human syndromes involving limb and ectodermal development including ADULT syndrome (acro-dermato-ungual- lacrimal-tooth syndrome), AEC syndrome (ankyloblepharon- ectodermal defects-cleft lip/palate), also known as Hay-Wells syndrome, EEC3, ectrodactyly, ectodermal dysplasia, and cleft lip/palate syndrome 3, SHFM4, split-hand/foot malformation 4, LMS, limb-mammary syndrome and RHS, Rapp-Hodgkin syndrome. In collaboration with the group of Volker Dötsch (Frankfurt University) we determined the crystal structure of the p63 tetramerization domain (TD), a domain that also forms hetero-tetramers with p73 but not with p53. Similar to structures of other family members, p63 forms a dimer of dimers with D2 symmetry. In contrast to p53, p63 and p73 contain an additional helix that stabilizes the tetrameric state. This second helix in the tetramerization domain seems to be an evolutionarily conserved structural element being present in many invertebrate p53 protein family members as well.

Materials and Methods

Entry Clone Source: Volker Dötsch group

Entry Clone Accession: GI:31543818

Vector: pNIC28-Bsa4 Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified DNA sequence:
GATGATGAACTGTTATACTTACCAGT
GAGGGGCCGTGAGACTTATGAAATGC
TGTTGAAGATCAAAGAGTCCCTGGAA
CTCATGCAGTACCTTCCTCAGCACAC
AATTGAAACGTACAGGCAACAGCAAC
AGCAGCAGCACCAGCACTTACTTCAG
AAACAGACCTCAATACAGTCT

Final protein sequence (Tag sequence in lowercase):
mghhhhhhdydipttenlyfq^gsDD
ELLYLPVRGRETYEMLLKIKESLELM
QYLPQHTIETYRQQQQQQHQHLLQKQ
TSIQS

^ TEV cleavage site

Tags and additions: Cleavable N-terminal His6 tag.

Host: BL21 (DE3)

Growth medium, induction protocol: 10 ml from a 50 ml overnight culture containing 100 µg/mL ampiciline were used to inoculate each of two 1 liter cultures of LB containing 100 µg/mL ampiciline. Cultures were grown at 37°C until the OD₆₀₀ reached ~0.6 then the temperature was adjusted to 22°C. Expression was induced overnight using 1 mM IPTG at an OD₆₀₀ of 0.8. The cells were collected by centrifugation and the pellet re-suspended in binding buffer and frozen.
Binding buffer: 50mM Tris buffer, pH 7.8; 500mM NaCl; 10 mM Imidazole
Extraction buffer, extraction method: Frozen pellets were thawed. Cells were lysed using sonication. The lysate was centrifuged at 17,000 rpm for 30 minutes and the supernatant collected for purification.

Column 1: Ni-affinity. Ni-sepharose (Amersham), 5 ml of 50% slurry in 1.5 x 10 cm column, washed with binding buffer

Column 1 Buffers:
Binding buffer: 50mM Tris buffer, pH 7.8; 500mM NaCl; 10 mM Imidazole
Wash buffer: 50mM Tris buffer, pH 7.8; 500mM NaCl; 30 mM Imidazole
Elution buffer: 50mM Tris buffer, pH 7.8; 500mM NaCl; 500 mM Imidazole.

Column 1 Procedure: The supernatant was loaded by gravity flow on the Ni-sepharose column. The column was washed first with 30 ml of binding buffer then with 30 ml of wash buffer at gravity flow. The protein was eluted by gravity flow by applying 5ml portions of elution buffer; fractions were collected until essentially all protein was eluted.

Enzymatic treatment: The N-terminal His tag was cleaved by treatment with TEV protease, overnight. Cleaved protein was purified by rebinding on 3 ml pre-equilibrated 50% Ni-NTA beads. The flow through fractions as well as fractions eluted with binding buffer were collected.

Column 2: 5 ml HiTrap Q HP

Column 2 Buffers:
Buffer A: 20mM Tris buffer, pH 8.5
Buffer B: 20mM Tris buffer, pH 8.5; 1 M NaCl

Column 2 Procedure: The column was equilibrated with 5 column volumes of Buffer A. The sample was applied to the column and the column eluted with a 20 column volume gradient from 0 mM to 500 mM NaCl. 1 ml fractions were collected and analysed by SDS-PAGE. The most pure fractions were pooled.

Column 3: Size Exclusion Chromatography; Superdex S75 16/60 HiLoad

Column 3 Buffers:
Buffer: 20mM Tris buffer, pH 7.8.

Column 3 Procedure: The eluted fractions from the Anion Exchange column were concentrated to a final volume of 5 mL and applied to an S75 16/60 HiLoad gel filtration column equilibrated in 20mM Tris buffer, pH 7.8 using an ÄKTAexpress system. Eluted proteins were collected in 2 mL fractions and analysed on SDS-PAGE

Protein concentration: The protein was concentrated to 104.5 mg/ml using an Amicon 10 kDa cut-off concentrator and stored at 4°C. The protein concentration was determined spectrophotometrically using ε₂₈₀ = 5960

Mass spectrometry characterization:
Measured mass:: 14535.8 Da
LC- ESI -MS TOF gave a measured mass of 14535.8 Da for the cleaved protein as predicted from the sequence.

Crystallisation: Crystals were grown by vapour diffusion at 20°C, in 150 nL sitting drops mixing 100 nL protein (15 mg/mL) and 50 nL mother liquor (35% w/v LMW PgSm) equilibrated against 20 µl reservoir containing mother liquor

Data collection:

Crystals were cryo-protected using the well solution and flash frozen in liquid nitrogen.

Phasing: The structure was solved by molecular replacement using an ensemble of p53 family tetramerization domain structures as a starting model

References

Coutandin, D., Lohr, F., Niesen, F.H., Ikeya, T., Weber, T.A., Schafer, B., Zielonka, E.M., Bullock, A.N., Yang, A., Guntert, P., et al. (2009). Conformational stability and activity of p73 require a second helix in the tetramerization domain. Cell Death Differ 16, 1582-1589.
Coutandin, D., Ou, H.D., Lohr, F., and Dotsch, V. (2010). Tracing the protectors path from the germ line to the genome. Proc Natl Acad Sci U S A 107, 15318-15325.
Deutsch, G.B., Zielonka, E.M., Coutandin, D., Weber, T.A., Schafer, B., Hannewald, J., Luh, L.M., Durst, F.G., Ibrahim, M., Hoffmann, J., et al. (2011). DNA damage in oocytes induces a switch of the quality control factor TAp63alpha from dimer to tetramer. Cell 144, 566-576.
Dotsch, V., Bernassola, F., Coutandin, D., Candi, E., and Melino, G. (2010). p63 and p73, the ancestors of p53. Cold Spring Harb Perspect Biol 2, a004887.
Koster, M.I., Dai, D., and Roop, D.R. (2007). Conflicting roles for p63 in skin development and carcinogenesis. Cell Cycle 6, 269-273.
Ou, H.D., Lohr, F., Vogel, V., Mantele, W., and Dotsch, V. (2007). Structural evolution of C-terminal domains in the p53 family. EMBO J 26, 3463-3473.
Petitjean, A., Hainaut, P., and Caron de Fromentel, C. (2006). TP63 gene in stress response and carcinogenesis: a broader role than expected. Bull Cancer 93, E126-135.
Rinne, T., Brunner, H.G., and van Bokhoven, H. (2007). p63-associated disorders. Cell Cycle 6, 262-268.
Serber, Z., Lai, H.C., Yang, A., Ou, H.D., Sigal, M.S., Kelly, A.E., Darimont, B.D., Duijf, P.H., Van Bokhoven, H., McKeon, F., et al. (2002). A C-terminal inhibitory domain controls the activity of p63 by an intramolecular mechanism. Mol Cell Biol 22, 8601-8611.
Straub, W.E., Weber, T.A., Schafer, B., Candi, E., Durst, F., Ou, H.D., Rajalingam, K., Melino, G., and Dotsch, V. (2010). The C-terminus of p63 contains multiple regulatory elements with different functions. Cell Death Dis 1, e5.