Activin receptor type-IIA (ACVR2A) kinase domain in complex with a beta-carboline inhibitor

Target ID:

ACVR2A

Aliases:

ACTRIIACVR2ACVR2A

Deposition Date:

Thursday 3rd May 2012

Families:

Protein Kinase

Related Diseases:

Cancer

Structure type:

protein-ligand

Download Coordinates:

4ASX

Authors:

Williams, E.,Chaikuad, A.,Canning, P.,Kochan, G.,Mahajan, P.,Cooper, C.D.O.,Beltrami, A.,Krojer, T.,Pohl, B.,Bracher, F.,Arrowsmith, C.H.,Edwards, A.M.,Bountra, C.,von Delft,F.,Bullock, A.

Site:

Oxford

4ASX

tabs

Structure Details

The activin receptor type-2A, ACVR2A, also known as ActRIIA, belongs together with ACVR2B to the subfamily of activin receptors. Both proteins are type II receptors from the BMP/TGF-β receptor family of transmembrane kinases. The protein is composed of an N-terminal extracellular ligand binding domain, a single transmembrane domain and a C-terminal Ser/Thr kinase domain with a C-terminal binding site for PDZ proteins. Ligand binding to activin type II receptor leads to recruitment of a type I receptor and its phosphorylation by ActRII. The activated type I receptor then binds and phosphorylates specific SMAD transcription factors (Tsuchida et al., 2008). ACVR2 can be activated not only by activins, but also by other ligands, including myostatin and certain bone morphogenic proteins (BMPs) (Tsuchida et al., 2004).

ACVR2A is involved in a variety of biological functions including muscle growth (Cadena et al., 2010) and bone formation (Lotinun et al., 2010) as well as viability and adhesion of prostatic epithelial cells (Simon et al., 2009). It also plays a role in the regulation of germ cells and is involved in BMP7-evoked chemotaxis tropic events (Perron and Dodd, 2009). Mice, in which ACVR2A has been deleted, are mostly healthy. However, a few have skeletal and facial abnormalities reminiscent of the Pierre Robin syndrome (Matzuk et al., 1995). Male ACVR2A knockout mice are fertile, but have suppressed pituitary and serum FSH levels, and demonstrate a decrease in testis size as a result of reduced Sertoli cells and germ cells (Kumar et al., 2001). They also show defective reproductive performance due to decreased NOS activity in the medial preoptic area (Ma et al., 2005). ACVR2A has been found to be commonly mutated in microsatellite unstable (MSI) colon cancers and its signaling is required for prostatic cancer cell viability. A soluble ACVR2A-IgG-Fc fusion protein (ACE-011) is a novel promising drug candidate for osteoporosis, cancer-related bone loss and cachexia. (Tsuchida et al., 2009).

Here we report the 2.05 Å crystal structure of the ACVR2A kinase domain in complex with the oxo-beta-carboline inhibitor Dihydro-Bauerine C. We thank Berthold Pohl and Franz Bracher for synthesis of this compound.

Dihydro Bauerine C

Materials and Methods

ACVR2A (4ASX) Materials & Methods

Entry clone source: Origene

Entry clone accession: GI:65508448

SGC Construct ID: ACVR2A-c046

Vector: pFB-LIC-Bse. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ].

DNA sequence:
TACTTCCAATCCATGCCACTGCAGTT
ATTAGAAGTGAAAGCAAGGGGAAGAT
TTGGTTGTGTCTGGAAAGCCCAGTTG
CTTAACGAATATGTGGCTGTCAAAAT
ATTTCCAATACAGGACAAACAGTCAT
GGCAAAATGAATACGAAGTCTACAGT
TTGCCTGGAATGAAGCATGAGAACAT
ATTACAGTTCATTGGTGCAGAAAAAC
GAGGCACCAGTGTTGATGTGGATCTT
TGGCTGATCACAGCATTTCATGAAAA
GGGTTCACTATCAGACTTTCTTAAGG
CTAATGTGGTCTCTTGGAATGAACTG
TGTCATATTGCAGAAACCATGGCTAG
AGGATTGGCATATTTACATGAGGATA
TACCTGGCCTAAAAGATGGCCACAAA
CCTGCCATATCTCACAGGGACATCAA
AAGTAAAAATGTGCTGTTGAAAAACA
ACCTGACAGCTTGCATTGCTGACTTT
GGGTTGGCCTTAAAATTTGAGGCTGG
CAAGTCTGCAGGCGATACCCATGGAC
AGGTTGGTACCCGGAGGTACATGGCT
CCAGAGGTATTAGAGGGTGCTATAAA
CTTCCAAAGGGATGCATTTTTGAGGA
TAGATATGTATGCCATGGGATTAGTC
CTATGGGAACTGGCTTCTCGCTGTAC
TGCTGCAGATGGACCTGTAGATGAAT
ACATGTTGCCATTTGAGGAGGAAATT
GGCCAGCATCCATCTCTTGAAGACAT
GCAGGAAGTTGTTGTGCATAAAAAAA
AGAGGCCTGTTTTAAGAGATTATTGG
CAGAAACATGCTGGAATGGCAATGCT
CTGTGAAACCATTGAAGAATGTTGGG
ATCACGACGCAGAAGCCAGGTTATCA
GCTGGATGTGTAGGTGAAAGAATTAC
CCAGATGCAGAGACTAACAAATATTT
GACAGTAAAGGTGGATA

Expressed protein sequence (His₆ affinity Tag sequence in lowercase):
mghhhhhhssgvdlgtenlyfq^SMP
LQLLEVKARGRFGCVWKAQLLNEYVA
VKIFPIQDKQSWQNEYEVYSLPGMKH
ENILQFIGAEKRGTSVDVDLWLITAF
HEKGSLSDFLKANVVSWNELCHIAET
MARGLAYLHEDIPGLKDGHKPAISHR
DIKSKNVLLKNNLTACIADFGLALKF
EAGKSAGDTHGQVGTRRYMAPEVLEG
AINFQRDAFLRIDMYAMGLVLWELAS
RCTAADGPVDEYMLPFEEEIGQHPSL
EDMQEVVVHKKKRPVLRDYWQKHAGM
AMLCETIEECWDHDAEARLSAGCVGE
RITQMQRLTNI

^ TEV protease recognition site

Tags and additions: Tev-cleavable N-terminal His6 tag

Host: SF9 Spodoptera frugiperda Insect cells.

Growth medium, induction protocol: 2L of SF9 cells at a density of 2 million/ml were infected with 10 ml of Virus/L.Cells were incubated at 27°C in the shaker incubator and harvested after 48 hours. Cells were harvested by centrifugation at 900g at 4°C for 20 min. Cell pellets from each flask (1l volume) were resuspended in 20 ml binding buffer (50 mM Hepes, pH 7.5; 500 mM NaCl; 5% Glycerol; 5 mM imidazole) in the presence of protease inhibitor SET V (Calbiochem) added to the cell suspension at 1:100 dilution, transferred to 50 ml tubes, and stored at 20°C.

Extraction buffer, extraction method: The frozen cells were thawed and 0.15% PEI (pH7.4) was added. The cells were lysed by passage 4-5x through an Emulsiflex C5 homogenizer. The cell lysate was spun down by centrifugation at 21.5K rpm at 4°C for 1 h. The supernatant was recovered for purification

Column 1: Ni-Affinity Chromatography. 4 ml of 50 % Ni-sepharose slurry was applied onto a 1.5 x 10 cm column. The column was equilibrated with binding buffer (25ml).

Column 1 Buffers:
Binding buffer: 50 mM Hepes, pH 7.5; 500 mM NaCl; 5% Glycerol; 5 mM imidazole0.5mM TCEP
Wash buffer: 50 mM Hepes, pH 7.5; 500 mM NaCl; 5% Glycerol; 25 mM imidazole0.1mM TCEP
Elution buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% Glycerol; 50 to 250 mM imidazole 0.5mM TCEP

Column 1 Procedure: The supernatant following centrifugation was applied by gravity flow onto the Ni-sepharose column. The bound protein was then washed with 50ml binding buffer and subsequently with 30 ml wash buffer. ACVR2A protein was then eluted by applying a step gradient of imidazole using 5 ml portions of elution buffer with increasing concentration of imidazole (50 mM, 100 mM, 150 mM, 250 mM). Elution fractions were analyzed by SDS PAGE and the 100, 150 and 250 mM imidazole fractions were kept and pooled. 10 mM DTT was added for overnight storage at 4°C.

Enzymatic treatment: The tag was not cleaved

Column 2: Size Exclusion Chromatography S200 HiLoad 16/60 Superdex run on ÄKTA-Express

Column 2 Buffers:
Gel Filtration buffer: 300 mM NaCl, 50 mM HEPES pH 7.5, 0.5 mM TCEP, pH 7.5

Column 2 Procedure: Prior to applying the protein, the S200 16/60 column was washed and equilibrated with gel filtration buffer. The protein was concentrated to 3 ml using an Amicon Ultra-15 filter with a 30 kDa cut-off. The concentrated protein was directly applied onto the equilibrated S200 16/60 column, and run at a flow-rate of 1 ml/min. Fractions containing the protein were pooled together.

Mass spec characterization:
The purified protein was homogeneous and had an experimental mass of 36410.6 Da. The theoretical expected mass from the construct primary sequence is 36497.9. The difference corresponds to loss of the N-terminal methionine and acetylation of the resulting N-terminus. Masses were determined by LC-MS, using an Agilent LC/MSD TOF system with reversed-phase HPLC coupled to electrospray ionisation and an orthogonal time-of-flight mass analyser. Proteins were desalted prior to mass spectrometry by rapid elution off a C3 column with a gradient of 5-95% methanol in water with 0.1% formic acid.

Concentration: Protein was concentrated to 12.4 mg/ml using an Amicon 30 kDa cut-off concentrator.

Crystallization: Protein was concentrated to 12.4 mg/ml in gel filtration buffer. The oxo-beta-carboline inhibitor Dihydro-Bauerine C (K01764) was added to the final sample at a concentration of 1mM. Crystals were grown at 4°C in 150 nl sitting drops mixing 100 nl protein solution with 50 nl of a reservoir solution containing 20% PEG 3350; 0.20M Na(malonate). On mounting crystals were cryo-protected with an additional 20% ethylene glycol.

Data Collection: Resolution: 2.05 Å
X-ray source: Diamond Light Source, station I04, using monochromatic radiation at wavelength 0.9611 Å

References

Cadena, S.M., Tomkinson, K.N., Monnell, T.E., Spaits, M.S., Kumar, R., Underwood, K.W., Pearsall, R.S., and Lachey, J.L. (2010). Administration of a Soluble Activin Type IIB Receptor Promotes Skeletal Muscle Growth Independent of Fiber Type. J Appl Physiol. J Appl Physiol. 109, 635-42.
Kumar, T.R., Varani, S., Wreford, N.G., Telfer, N.M., de Kretser, D.M., and Matzuk, M.M. (2001). Male reproductive phenotypes in double mutant mice lacking both FSHbeta and activin receptor IIA. Endocrinology 142, 3512-3518.
Lotinun, S., Pearsall, R.S., Davies, M.V., Marvell, T.H., Monnell, T.E., Ucran, J., Fajardo, R.J., Kumar, R., Underwood, K.W., Seehra, J., et al. (2010). A soluble activin receptor Type IIA fusion protein (ACE-011) increases bone mass via a dual anabolic-antiresorptive effect in Cynomolgus monkeys. Bone 46, 1082-1088.
Ma, X., Reyna, A., Mani, S.K., Matzuk, M.M., and Kumar, T.R. (2005). Impaired male sexual behavior in activin receptor type II knockout mice. Biol Reprod 73, 1182-1190.
Matzuk, M.M., Kumar, T.R., and Bradley, A. (1995). Different phenotypes for mice deficient in either activins or activin receptor type II. Nature 374, 356-360.
Perron, J.C., and Dodd, J. (2009). ActRIIA and BMPRII Type II BMP receptor subunits selectively required for Smad4-independent BMP7-evoked chemotaxis. PLoS One 4, e8198.
Pohl, B., Luchterhandt, T., Bracher, F. (2007) Total syntheses of the chlorinated beta-carboline alkaloids bauerine A, B and C. Synth. Commun. 37, 1273.
Simon, D.P., Vadakkadath Meethal, S., Wilson, A.C., Gallego, M.J., Weinecke, S.L., Bruce, E., Lyons, P.F., Haasl, R.J., Bowen, R.L., and Atwood, C.S. (2009). Activin receptor signaling regulates prostatic epithelial cell adhesion and viability. Neoplasia 11, 365-376.
Tsuchida, K., Nakatani, M., Hitachi, K., Uezumi, A., Sunada, Y., Ageta, H., and Inokuchi, K. (2009). Activin signaling as an emerging target for therapeutic interventions. Cell Commun Signal 7, 15.
Tsuchida, K., Nakatani, M., Matsuzaki, T., Yamakawa, N., Liu, Z., Bao, Y., Arai, K.Y., Murakami, T., Takehara, Y., Kurisaki, A., et al. (2004). Novel factors in regulation of activin signaling. Mol Cell Endocrinol 225, 1-8.
Tsuchida, K., Nakatani, M., Uezumi, A., Murakami, T., and Cui, X. (2008). Signal transduction pathway through activin receptors as a therapeutic target of musculoskeletal diseases and cancer. Endocr J 55, 11-21.