Tandem Vhs and Fyve Domains of Hepatocyte Growth Factor-Regulated Tyrosine Kinase Substrate (Hgs-Hrs) bound to an IP2 compound at 1.68Ã… Resolution

Target ID:

HGSA

Deposition Date:

Wednesday 30th May 2012

Families:

Miscellaneous

Structure type:

protein-ligand

Download Coordinates:

4AVX

Authors:

E.Williams,P.Canning,L.Shrestha,T.Krojer,M.Vollmar,A.Slowey,S.Conway,F.Von Delft,C.H.Arrowsmith,A.M.Edwards,J.Weigelt,C.Bountra,A.Bullock

Site:

Oxford

4AVX

tabs

Structure Details

Hepatocyte growth factor-regulated tyrosine kinase substrate (HGS/Hrs) is conserved from mammals to yeast (Vps27) and together with STAM is a component of the ESCRT 0 protein complex that captures ubiquitylated receptor proteins and sorts them to the lysosomal pathway. Other receptors may be recycled to the plasma membrane. Mice lacking Hrs die early in embryonic development and have abnormally enlarged endosomes, suggestive of defects in sorting. Cellular knock down of Hrs attenuated tumour cell growth and metastasis The Endosomal Sorting Complexes Required for Transport (ESCRT) machinery is also required for the final stages of assembly of a number of viruses. Knock down of Hrs increases cellular levels of BST-2/tetherin and restricts HIV-1 release. Hrs is also linked to the ubiquitin-independent endosomal sorting of interleukin-2 receptor β (IL-2Rβ).

Hrs contains VHS, FYVE, ubiquitin interaction motif (UIM) and GAT domains as well as a clathrin binding domain. The FYVE domain binds PtdIns3P (PI3P) and localizes Hrs to endosomes, whereas the GAT domain mediates assembly with STAM. Other domains, including the VHS and UIM domains, present multiple sites for protein capture. We previously solved the high resolution structure of the tandem VHS and FYVE domains of human Hrs refined at 1.5Å resolution (PDB 3ZYQ). Here we present the structure bound to inositol 1,3-diphosphate refined at 1.68Å resolution.

Materials and Methods

HGSA (4AVX) Materials & Methods

Entry Clone Source: MGC

SGC Construct ID: HGSA-c001

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]. T7/lac regulated, N-terminal His-tag, TEV, LIC cloning using BsaI cleavage/T4 polymerase, SacB stuffer fragment, pET28 backbone

DNA sequence:
TACTTCCAATCCATGGGGCGAGGCAG
CGGCACCTTCGAGCGTCTCCTAGACA
AGGCGACCAGCCAGCTCCTGTTGGAG
ACAGATTGGGAGTCCATTTTGCAGAT
CTGCGACCTGATCCGCCAAGGGGACA
CACAAGCAAAATATGCTGTGAATTCC
ATCAAGAAGAAAGTCAACGACAAGAA
CCCACACGTCGCCTTGTATGCCCTGG
AGGTCATGGAATCTGTGGTAAAGAAC
TGTGGCCAGACAGTTCATGATGAGGT
GGCCAACAAGCAGACCATGGAGGAGC
TGAAGGACCTGCTGAAGAGACAAGTG
GAGGTAAACGTCCGTAACAAGATCCT
GTACCTGATCCAGGCCTGGGCGCATG
CCTTCCGGAACGAGCCCAAGTACAAG
GTGGTCCAGGACACCTACCAGATCAT
GAAGGTGGAGGGGCACGTCTTTCCAG
AATTCAAAGAGAGCGATGCCATGTTT
GCTGCCGAGAGAGCCCCAGACTGGGT
GGACGCTGAGGAATGCCACCGCTGCA
GGGTGCAGTTCGGGGTGATGACCCGT
AAGCACCACTGCCGGGCGTGTGGGCA
GATATTCTGTGGAAAGTGTTCTTCCA
AGTACTCCACCATCCCCAAGTTTGGC
ATCGAGAAGGAGGTGCGCGTGTGTGA
GCCCTGCTACGAGCAGCTGAACAGGA
AAGCGGAGGGATGACAGTAAAGGTGG
ATA

Final protein sequence (Tag sequence in lowercase):
mhhhhhhssgvdlgtenlyfq^sMGR
GSGTFERLLDKATSQLLLETDWESIL
QICDLIRQGDTQAKYAVNSIKKKVND
KNPHVALYALEVMESVVKNCGQTVHD
EVANKQTMEELKDLLKRQVEVNVRNK
ILYLIQAWAHAFRNEPKYKVVQDTYQ
IMKVEGHVFPEFKESDAMFAAERAPD
WVDAEECHRCRVQFGVMTRKHHCRAC
GQIFCGKCSSKYSTIPKFGIEKEVRV
CEPCYEQLNRKAEG

^ TEV protease recognition site

Tags and additions: Cleavable N-terminal His6 tag

Host: BL21(DE3)-R3-pRARE2. Phage-resistant derivative of BL21 (DE3), with pRARE2 plasmid encoding rare codon tRNAs (chloramphenicol-resistant).

Growth Medium & Induction Protocol: A glycerol stock was used to inoculate a 50ml starter culture containing LB media with 50µg/ml Kanamycin and 34µg/ml Chloramphenicol. The starter culture was grown overnight at 37°C with shaking at 200 rpm. The following morning, three flasks containing 1L TB/Kanamycin were each inoculated with 10 ml of the starter culture. Cultures were incubated at 37°C with shaking at 180 rpm until an OD₆₀₀nm = 0.8 was reached. The flasks were then cooled down to 18°C and 1mM IPGT was added to induce protein expression overnight. Cells were harvested by centrifugation at 5000 rpm at 4°C for 15 min. Cell pellets from each flask were resuspended in 15ml Binding buffer (50mM HEPES, pH 7.5; 500mM NaCl; 5% Glycerol; 5mM Imidazole).

Extraction buffer, extraction method: The cells were lysed by ultrasonication over 25 min with the sonicator pulsing ON for 10 sec and OFF for 20 sec and 0.15% final concentration of 5% PEI was added. The cell lysate was spun down by centrifugation at 21000 rpm at 4°C for 1 h. The supernatant was recovered for purification.

Column 1: Ni-Affinity Chromatography 5ml of 50 % Ni-IDA slurry was applied onto a 1.5 x 10 cm column. The column was first washed with deionised distilled H₂O, and then equilibrated with Binding buffer

Column 1 Buffers:
Lysis buffer: 50mM HEPES, pH 7.5; 500mM NaCl; 5% Glycerol; 5mM Imidazole 0.5mM TCEP
Wash buffer: 50mM HEPES, pH 7.5; 500mM NaCl; 5% Glycerol; 30mM Imidazole, 0.5mM TCEP
Elution buffer: 50mM HEPES, pH 7.5; 500mM NaCl; 5% Glycerol; 50 to 250mM Imidazole, 0.5mM TCEP

Column 1 Procedure: The supernatant was applied by gravity flow onto the Ni column. The Ni column was washed with Wash buffer and the bound protein was eluted by applying a step gradient of Imidazole (5 ml fractions of Elution buffer supplemented with 50mM, 100mM, 150mM and 250mM Imidazole). Collected fractions were pooled and stored at 4°C.

Growth Medium & Induction Protocol: A glycerol stock was used to inoculate a 50ml starter culture containing LB media with 50µg/ml Kanamycin and 34µg/ml Chloramphenicol. The starter culture was grown overnight at 37°C with shaking at 200 rpm. The following morning, three flasks containing 1L TB/Kanamycin were each inoculated with 10 ml of the starter culture. Cultures were incubated at 37°C with shaking at 180 rpm until an OD600nm = 0.8 was reached. The flasks were then cooled down to 18°C and 1mM IPGT was added to induce protein expression overnight. Cells were harvested by centrifugation at 5000 rpm at 4°C for 15 min. Cell pellets from each flask were resuspended in 15ml Binding buffer (50mM HEPES, pH 7.5; 500mM NaCl; 5% Glycerol; 5mM Imidazole).

Column 2: Size Exclusion Chromatography - HiLoad 16/60 Superdex S75 (GE Healthcare)

Column 2 Buffers:
Gel Filtration buffer: 300mM NaCl, 50mM HEPES pH 7.5, 0.5mM TCEP

Column 2 Procedure: The Superdex S75 column was first equilibrated with Gel Filtration buffer. Concentrated the protein fraction from above step to

Mass spec characterization: Pending analysis

Crystallization: Protein was buffered in 50mM HEPES pH 6, 300mM NaCl, 0.5 mM TCEP. Protein was concentrated to 15 mg/ml (calculated using extinction co-efficient of 26930). Native crystals were grown at 20°C in 150nl sitting drops mixing 50nl protein solution with 100nl of a reservoir solution containing 25% PEG 3350, 0.1M Bis-Tris pH 5.5. On mounting crystals were cryo-protected with an additional 25% Ethylene glycol.

Data Collection:
Resolution: 1.68Å X-ray source: Diamond IO3

References

Janvier K, Pelchen-Matthews A, Renaud JB, Caillet M, Marsh M, Berlioz-Torrent C. (2011). The ESCRT-0 component HRS is required for HIV-1 Vpu-mediated BST-2/tetherin down-regulation. PLoS Pathog. 7, e1001265.
Ren X, Kloer DP, Kim YC, Ghirlando R, Saidi LF, Hummer G, Hurley JH. (2009). Hybrid structural model of the complete human ESCRT-0 complex. Structure. 17, 406-16.
Toyoshima M, Tanaka N, Aoki J, Tanaka Y, Murata K, Kyuuma M, Kobayashi H, Ishii N, Yaegashi N, Sugamura K. (2007). Inhibition of tumor growth and metastasis by depletion of vesicular sorting protein Hrs: its regulatory role on E-cadherin and beta-catenin. Cancer Res. 67, 5162-71.
Stern KA, Visser Smit GD, Place TL, Winistorfer S, Piper RC, Lill NL. (2007). Epidermal growth factor receptor fate is controlled by Hrs tyrosine phosphorylation sites that regulate Hrs degradation. Mol Cell Biol. 27, 888-98.
Pullan L, Mullapudi S, Huang Z, Baldwin PR, Chin C, Sun W, Tsujimoto S, Kolodziej SJ, Stoops JK, Lee JC, Waxham MN, Bean AJ, Penczek PA. (2006). The endosome-associated protein Hrs is hexameric and controls cargo sorting as a "master molecule". Structure. 14, 661-71.
Hirano S, Kawasaki M, Ura H, Kato R, Raiborg C, Stenmark H, Wakatsuki S. (2006). Double-sided ubiquitin binding of Hrs-UIM in endosomal protein sorting. Nat Struct Mol Biol. 13, 272-7.
Hanyaloglu AC, McCullagh E, von Zastrow M. (2005). Essential role of Hrs in a recycling mechanism mediating functional resensitization of cell signaling. EMBO J. 24, 2265-83.
Kobayashi H, Tanaka N, Asao H, Miura S, Kyuuma M, Semura K, Ishii N, Sugamura K. (2005). Hrs, a mammalian master molecule in vesicular transport and protein sorting, suppresses the degradation of ESCRT proteins signal transducing adaptor molecule 1 and 2. J Biol Chem. 280, 10468-77.
Lloyd TE, Atkinson R, Wu MN, Zhou Y, Pennetta G, Bellen HJ. (2002). Hrs regulates endosome membrane invagination and tyrosine kinase receptor signaling in Drosophila. Cell. 108, 261-9.
Mao Y, Nickitenko A, Duan X, Lloyd TE, Wu MN, Bellen H, Quiocho FA. (2000). Crystal structure of the VHS and FYVE tandem domains of Hrs, a protein involved in membrane trafficking and signal transduction. Cell. 100, 447-56.