PX domain of human sorting nexin SNX27

Target ID:

SNX27A

Deposition Date:

Thursday 27th September 2012

Families:

PDZ linkers

Structure type:

apo

Download Coordinates:

4HAS

Authors:

D. Sean Froese, T. Krojer, C. Strain-Damerell, C. Allerston, W. Kiyani, N. Burgess-Brown, F. von Delft, C. Arrowsmith, C. Bountra, A. Edwards, W.W. Yue

Site:

Oxford

4HAS

tabs

Structure Details

Sorting nexins (SNXs) represent a large, diverse but evolutionarily conserved family of cytosolic and membrane-bound proteins, which play an important role in endocytosis and protein trafficking [1]. They are characterized by the presence of a Phox homology (PX) domain of ~100-140 aa long. PX domains are membrane recruitment modules that employ a positively charged cleft to bind phosphoinositide (PtdInsP) lipids, thereby targeting proteins to membranes. SNX members vary in their specificities and affinities for PtdInsP, and together form part of the endosomal network, a complex series of membrane-bound compartments through which cargo is internalized by endocytosis, and sorted for recycling or degradation in the lysosome.

There are more than 40 human proteins known to contain a PX domain to date [2], some of which are annotated based on conserved sequence elements and database searches. Sorting nexin 27 (SNX27), also called Mrf1, is the only sorting nexin member that contains a PDZ domain in addition to the PX domain. SNX27 belongs to a subset of sorting nexins, alongside with SNX17 and SNX31, which have been implicated in the cargo retrieval of ion channels and receptors (e.g. β2-adrenoreceptor) from the endosome back to the plasma membrane [3,4]. The PDZ domain is likely to be involved in this endosome-to-plasma membrane sorting traffic, via an interaction with a C-terminal sequence motif of the transmembrane protein [3]. Here, we have determined the crystal structure of human SNX24 PX domain, in order to provide a molecular template to further understand its function and biochemical properties. Attempts to crystallize the PX-PDZ tandem construct are currently underway.

Materials and Methods

SNX27A (4HAS) Materials & Methods

Entry clone source: MGC

Entry clone accession: gi| 8069330

SGC Construct ID: SNX27A-c006

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ].

DNA sequence:
CATATGCACCATCATCATCATCATTC
TTCTGGTGTAGATCTGGGTACCGAGA
ACCTGTACTTCCAATCCATGGATTAC
ACAGAAAAGCAAGCAGTGCCCATATC
GGTCCCCAGATACAAACATGTGGAGC
AGAATGGTGAGAAGTTTGTGGTATAT
AATGTTTACATGGCAGGGAGGCAGCT
GTGTTCTAAGCGGTACCGGGAGTTTG
CTATCCTACACCAGAACCTGAAGAGA
GAGTTTGCCAACTTTACATTTCCTCG
ACTCCCAGGGAAGTGGCCATTTTCAT
TATCAGAACAACAATTAGATGCCCGA
CGTCGGGGATTGGAAGAATATCTAGA
AAAAGTGTGTTCAATACGAGTAATTG
GTGAGAGTGACATCATGCAGGAATTC
CTATCAGAATCCTGACAGTAAAGGTG
GATACGGATCCGAA

Final protein sequence (His₆ affinity Tag sequence in lowercase):
mhhhhhhssgvdlgtenlyfq^smDY
TEKQAVPISVPRYKHVEQNGEKFVVY
NVYMAGRQLCSKRYREFAILHQNLKR
EFANFTFPRLPGKWPFSLSEQQLDAR
RRGLEEYLEKVCSIRVIGESDIMQEF
LSES

^ TEV protease recognition site

Tags and additions: Cleavable N-terminal His6 tag

Host: BL21(DE3)-R3-pRARE2.

Transformation and Glycerol stock preparation: The construct DNA was transformed into competent cells of the expression strain by a standard heat shock procedure. One colony from the transformation was used to inoculate 1 ml of TB media containing 50 ìg/ml kanamycin and 34 ìg/ml chloramphenicol, which was placed in a 37°C shaker overnight. The next day glycerol stocks were prepared from this overnight culture.

Expression: A glycerol stock was used to inoculate 2X60 ml of TB media containing 50 µg/ml kanamycin and 50 µg/ml chloramphenicol, which was placed in a 37°C shaker overnight. The next day this starter culture was used to inoculate 12L of TB media (10 ml starter culture used per 1L) containing 50 ìg/ml kanamycin. When the OD600 reached approximately 1.0 the temperature was reduced to 18°C and after a further 30 minutes the cells were induced by the addition of 0.1 mM IPTG. Expression was continued overnight.

Cell harvest: Cells were harvested by centrifugation at 6000 x g after which the supernatant was poured out and the cell pellet placed in a -80°C freezer.

Cell Lysis: Cell pellets were dissolved in approximately 50ml lysis buffer and broken by homogenization by 5 passes at 12,000 psi. The cell debris was pelleted at 40,000 x g and the supernatant used for further purification.
Lysis buffer: 50 mM Hepes pH 7.4, 500 mM NaCl, 5% Glycerol, 10 mM Imidazole pH 7.4, 0.5 mM TCEP, 1 tablet per 50 ml protease inhibitor cocktail EDTA-free (Roche)

Column 1: Ni-NTA (1.5 ml volume in a gravity-flow column).

Column 1 Buffers:
Binding buffer: 50 mM Hepes pH 7.4, 500 mM NaCl, 5% Glycerol, 10 mM Imidazole pH 7.4, 0.5 mM TCEP
Elution buffer: 50 mM Hepes pH 7.4, 500 mM NaCl, 5% Glycerol, 40 mM Imidazole pH 7.4, 0.5 mM TCEP
Elution buffer: 50 mM Hepes pH 7.4, 500 mM NaCl, 5% Glycerol, 250 mM Imidazole pH 7.4, 0.5 mM TCEP

Column 1 Procedure: The clarified cell extract was incubated with 1.5 ml of Ni-NTA pre-equilibrated with lysis buffer for 1 hour at 4°C with rotation after which it was passed through a glass column. The column was then washed with Binding Buffer (2 x 20 ml) and Wash Buffer (2 x 15 ml). The protein was eluted with 25 ml of Elution Buffer in 5 x 5 ml fractions.

Column 2: Superdex 200 16/60 Gel Filtration.

Column 2 Buffers:
Gel Filtration buffer: 10 mM Hepes pH 7.4, 500 mM NaCl, 0.5 mM TCEP, 5% Glycerol.

Column 2 Procedure: The two wash buffer fractions from column 1 were pooled and concentrated to 5 ml with a 10 kDa mwco spin concentrator and injected into an s200 16/60 column (pre-equilibrated in GF Buffer) at 1.0 ml/min. 1.0 ml fractions were collected. The protein eluted at between 100 ml and 110 ml volume.

Column 3: TEV cleavage/ Ni-NTA rebind

Column 3 Procedure: Protein from fractions eluted at 100-110 ml from s200 gel filtration were pooled and incubated with 1:20 mol:mol TEV protease overnight at 4°C. Then protein plus TEV was passed through a column containing 0.25 ml Ni-NTA pre-equilibrated with GF Buffer. Column was washed 2 x 500 µl of GF Buffer, 2 x 500 µl of Binding Buffer, 2 x 500 µl of Wash Buffer and 2 x 500 µl of Elution Buffer. Flow-through and GF Buffer were pooled.

Concentration: Pooled protein fractions were concentrated to 16 mg/ml using a 10 kDa mwco concentrator.

Mass spec characterization (after TEV protease digestion):
Expected mass: 13284.2 Da, Measured mass: 13284.24 Da

Crystallization: Crystals were grown by vapour diffusion in sitting drop at 4°C. A sitting drop consisting of 50 nl protein and 100 nl well solution was equilibrated against well solution containing 0.1 M citrate pH 5.5 and 18% PEG 3350 . Crystals were mounted in the presence of 25% (v/v) ethylene glycol and flash-cooled in liquid nitrogen.

Data Collection: 1.80 Å X-ray source: FREL

References

Worby CA, Dixon JE (2002). Sorting out the cellular functions of sorting nexins. Nat Rev Mol Cell Biol 3:919-931.
Teasdale RD, Collins BM (2012). Insights into the PX (phox-homology) domain and SNX (sorting nexin) protein families: structures, functions and roles in disease. Biochem J. 441:39-59.
Lauffer BE, Melero C, Temkin P, Lei C, Hong W, Kortemme T, von Zastrow M (2010). SNX27 mediates PDZ-directed sorting from endosomes to the plasma membrane. J Cell Biol 190:565-74.
Lunn ML, Nassirpour R, Arrabit C, Tan J, McLeod I, Arias CM, Sawchenko PE, Yates JR 3rd, Slesinger PA (2007). A unique sorting nexin regulates trafficking of potassium channels via a PDZ domain interaction. Nat Neurosci 10:1249-59.