Human cyclin G associated kinase

Target ID:

GAKA

Aliases:

FLJ40395GAKMGC99654

Deposition Date:

Friday 29th January 2010

Families:

Protein Kinase

Related Diseases:

CancerSignalling

Structure type:

apo

Download Coordinates:

4O38

Authors:

R. Zhang, C. Hatzos-Skintges, A. Weger, J. Eswaran, O. Fedorov, O. King, F. Von Delft, C. Bountra, , C.H. Arrowsmith, J. Weigelt, , A. Edwards, S. Knapp, A. Joachimiak, Midwest Center for Structural Genomics (MCSG)

Site:

Oxford

4O38

tabs

Structure Details

GAK has been originally identified as an association partner of cyclin G and CDK5. It is ubiquitously expressed with highest levels in testis (Kimura et al., 1997). GAK shows striking homology (43% identity on the amino acid level) in its C-terminus to a brain specific protein termed auxilin involved in uncoating of clathrin vesicles. In addition, GAK possesses an N-terminal kinase domain with Ser/Thr activity which is homologous to the one of the Saccharomyces cerevisiae Ark/Prk proteins, a kinase that plays a role as a regulator of endocytosis and the actin cytoskeleton (Smythe and Ayscough, 2003). The C-terminal GAK domain consists of three subdomains, an N-terminal tensin-like domain, also called PTEN domain binding to phospholipids, a clathrin-binding domain, that can assemble clathrin into clathrin baskets and a C-terminal J-domain interacting with Heat shock 70 kDa protein 80 (hsc70) (Eisenberg and Greene, 2007) (Korolchuk and Banting, 2002).

GAK is thought to be the ubiquitous counterpart of auxillin and functions by cooperating with Hsc70 during uncoating of clathrin vesicles but is thought to function also in vesicles coating via its kinases domain (Korolchuk and Banting, 2002). In addition GAK kinase activity has also been shown to be important for lysosomal sorting (Kametaka et al., 2007). GAK also mediates the binding of clathrin and adaptors to the plasma membrane and the trans-Golgi network and regulates receptor signaling by influencing trafficking downstream of clathrin coated vesicles (Lee et al., 2005), (Zhang et al., 2005).

Recently it has been shown that GAK through its interaction with clathrin has additional important functions in the nucleus. It is required for the maintenance of proper centrosome maturation and involved in control of mitotic chromosome congression (Shimizu et al., 2009). The nuclear function of GAK might help in understanding the sever phenotype of the generated GAK knockout models that demonstrated the GAK is an essential gene in development as well as in adult mice. Conventional GAK-/- mice die early during gestation. Conditional knockout of GAK in skin, liver or the developing brain also resulted in lethal phenotypes shortly after birth with severe alteration of the affected tissues and failure of progenitor cells to differentiate. Even an inducible knockout mouse model in adult mice results in death of these animals after three weeks (Lee et al., 2008). GAK has also been suggested to play a role in tumorigenesis but its role as tumor promoter or tumor suppressor is still not clear (Zhang et al., 2004) (Ray et al., 2006). Here we report the structure of the kinase domain of GAK at 2.1 Å resolution.

Materials and Methods

GI number: gi|4885251

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified construct sequence:
ATGCACCATCATCATCATCATTCTTCTGGT
GTAGATCTGGGTACCGAGAACCTGTACTTC
CAATCCATGGCGGGTCCAGGCTCCCTGGGC
GGTGCTTCCGGCCGCGACCAGAGTGACTTC
GTGGGGCAGACGGTGGAACTGGGCGAGCTG
CGGCTGCGGGTGCGGCGGGTCCTGGCCGAA
GGAGGGTTTGCATTTGTGTATGAAGCTCAA
GATGTGGGGAGTGGCAGAGAGTATGCATTA
AAGAGGCTATTATCCAATGAAGAGGAAAAG
AACAGAGCCATCATTCAAGAAGTTTGCTTC
ATGAAAAAGCTTTCCGGCCACCCGAACATT
GTCCAGTTTTGTTCTGCAGCGTCTATAGGA
AAAGAGGAGTCAGACACGGGGCAGGCTGAG
TTCCTCTTGCTCACAGAGCTCTGTAAAGGG
CAGCTGGTGGAATTTTTGAAGAAAATGGAA
TCTCGAGGCCCCCTTTCGTGCGACACGGTT
CTGAAGATCTTCTACCAGACGTGCCGCGCC
GTGCAGCACATGCACCGGCAGAAGCCGCCC
ATCATCCACAGGGACCTCAAGGTTGAGAAC
TTGTTGCTTAGTAACCAAGGGACCATTAAG
CTGTGTGACTTTGGCAGTGCCACGACCATC
TCGCACTACCCTGACTACAGCTGGAGCGCC
CAGAGGCGAGCCCTGGTGGAGGAAGAGATC
ACGAGGAATACAACACCAATGTATAGAACA
CCAGAAATCATAGACTTGTATTCCAACTTC
CCGATCGGCGAGAAGCAGGATATCTGGGCC
CTGGGCTGCATCTTGTACCTGCTGTGCTTC
CGGCAGCACCCTTTTGAGGATGGAGCGAAA
CTTCGAATAGTCAATGGGAAGTACTCGATC
CCCCCGCACGACACGCAGTACACGGTCTTC
CACAGCCTCATCCGCGCCATGCTGCAGGTG
AACCCGGAGGAGCGGCTGTCCATCGCCGAG
GTGGTGCACCAGCTGCAGGAGATCGCGGCC
GCCCGCAACGTGAACCCCAAGTCTCCCATC
ACAGAGCTCCTGGAGCAGAATGGAGGCTAC
GGGAGCGCCACACTGTCCCGAGGGCCATGA

Expressed sequence:
mhhhhhhssgvdlgtenlyfq*smAGPGSLGGAS
GRDQSDFVGQTVELGELRLRVRRVLA
EGGFAFVYEAQDVGSGREYALKRLLS
NEEEKNRAIIQEVCFMKKLSGHPNIV
QFCSAASIGKEESDTGQAEFLLLTELC
KGQLVEFLKKMESRGPLSCDTVLKIF
YQTCRAVQHMHRQKPPIIHRDLKVE
NLLLSNQGTIKLCDFGSATTISHYPD
YSWSAQRRALVEEEITRNTTPMYRT
PEIIDLYSNFPIGEKQDIWALGCILYL
LCFRQHPFEDGAKLRIVNGKYSIPPH
DTQYTVFHSLIRAMLQVNPEERLSIA
EVVHQLQEIAAARNVNPKSPITELLE
QNGGYGSATLSRGP

* TEV cleavage site; the vector-derived sequences are in lowercase.

Tags and additions: Cleavable N-terminal His6 tag.

Host: BL21 (DE3)R3-pRARE2 (Phage resistant strain).

Growth medium, induction protocol: 50µl of LB culture started from glycerol stocks was added to 50mls fresh Minimal Pink Medium (MCSG) containing 1.5mg kanamycin, 7.5mg amplicillin, 0.05mg vitamin B1, and 0.135 mg vitamin B12, M9 salts, non-inhibitory amino acids, metal supplements, glucose and glycerol as described in paper (Donnelly, MI et al, 2006). Cultures were grown over-night at 37°C (150rpm). The 50ml over-night culture was divided equally in to 2 x 1L of freshly prepared Minimal Pink Medium. Cultures were grown at 37°C (180rpm) until the OD₆₀₀ reached ~1.0. Next, 90mg of seleno-methionine and 150mg each of inhibitory amino acids (VILKTF) was added and culture was transferred to a pre-cooled 4°C incubator (180rpm) for 1 hour. Next, protein expression was induced using 0.5 mM IPTG.Â Cultures were switched to an 18°C incubator and grown over-night. The cells were collected by centrifugation and the pellet re-suspended in lysis buffer and frozen in -80°C.
Lysis buffer: 50 mM HEPES pH 8.0; 500 mM NaCl; 20 mM Imidazole, 5 % Glycerol, 10mM Beta-mercaptoethanol.
Extraction buffer, extraction method: Frozen cell pellets were thawed and fresh lysozyme was added at a final concentration of 1mg/mL to the 40mL of lysate. Cells were further lysed using sonication (Misonix 3000). The lysate was centrifuged (RC5C-Plus centrifuge, Sorval SS-34 rotor) at 13,000 rpm for 45 minutes and the supernatant was filtered through a 0.45µm in line filter (Pall) prior to loading on nickel columns (GE HS) using ÄKTA Xpress.

Buffers for Immobilized Metal Affinity Chromatography I (IMAC I) Using the ÄKTA Xpress (General Electric Health Systems (GE HS)):
Desalting buffer: 50 mM HEPES pH 8.0, 500 mM NaCl, 5% Glycerol, 10mM Beta-mercaptoethanol.
Lysis buffer: 50 mM HEPES pH 8.0, 500 mM NaCl, 20 mM Imidazole, 5% Glycerol, 10mM Beta-mercaptoethanol.
Elution buffer: 50 mM HEPES pH 8.0, 500 mM NaCl, 250 mM Imidazole , 5% Glycerol, 10mM Beta-mercaptoethanol.

IMAC I Procedure and TEV Protease Cleavage: IMAC-I using a 5-ml HiTrap Chelating HP column charged with Ni⁺² ions and buffer-exchange chromatography on a HiPrep 26/10 desalting column (both GE Health Systems) were performed using ÄKTA Xpress (GE HS). The His6-tag was cleaved using the recombinant TEV protease expressed from the vector pRK5084 (a gift from Dr. D. Waugh, NCI). The TEV protease was added to the target protein in a ratio of 1:50 and the solution was incubated at 4°C for 48 hours.

Buffers for Immobilized Metal Affinity Chromatography II (IMAC II) Using the ÄKTA Xpress (GE HS):
Lysis buffer: 50 mM HEPES pH 8.0, 500 mM NaCl, 20 mM Imidazole, 5% Glycerol, 10mM Beta-mercaptoethanol.
Elution buffer: 50 mM HEPES pH 8.0, 500 mM NaCl, 250 mM Imidazole, 5% Glycerol, 10mM Beta-mercaptoethanol.

IMAC II Procedure: The proteins with His6-tag removed were purified IMAC-II using a 5-ml HiTrap Chelating HP column (GE HS) charged with Ni⁺² ions. Protein was eluted and collected at Imidazole concentrations of 20 mM and 35 mM.

Mass spectrometry characterization: Not determined

Protein concentration: Protein was buffer exchanged in to crystallization buffer (20 mM HEPES pH 8.0, 250 mM NaCl, and 2 mM dithiothreitol (DTT)) during concentration and concentrated to 16 mg/ml using an Amicon Ultra 15 - 3 kDa cut-off concentrator.

Crystallisation: Protein was proteolyzed with 1mg/ml chymotrypsin (1:80 v/v) for 2 hours on ice prior to crystallization set-up. Crystals were grown at 16°C in 400 nL sitting drops from a 1:1 ratio of reservoir solution (1.0M succinic acid pH 7.0, 0.1M Bis-Tris Propane pH 7.0) and proteolyzed protein.

Data Collection: Crystals were cryo-protected using the reservoir well solution supplemented with 25% glycerol and flash frozen in liquid nitrogen.
X-ray source: Diffraction data were collected from a single crystal on APS beamline 19ID at a single wavelength of 0.9794 Å.
Phasing: The structure was by solved via SAD phasing using Se anomalous signal.Â The resolution is 2.1 Å and is deposited to PDB (3LL6).

Reference: Donnelly, M.I., Zhou, M., Millard, C.S., Stols, L., Eschenfeldt, W.H., Collart, F.R. and Joachimiak, A. (2006) Protein Expression and Purification 47:446-454.

References

Eisenberg, E., and Greene, L.E. (2007). Multiple roles of auxilin and hsc70 in clathrin-mediated endocytosis. Traffic 8, 640-646.
Kametaka, S., Moriyama, K., Burgos, P.V., Eisenberg, E., Greene, L.E., Mattera, R., and Bonifacino, J.S. (2007). Canonical interaction of cyclin G associated kinase with adaptor protein 1 regulates lysosomal enzyme sorting. Mol Biol Cell 18, 2991-3001.
Kimura, S.H., Tsuruga, H., Yabuta, N., Endo, Y., and Nojima, H. (1997). Structure, expression, and chromosomal localization of human GAK. Genomics 44, 179-187.
Korolchuk, V.I., and Banting, G. (2002). CK2 and GAK/auxilin2 are major protein kinases in clathrin-coated vesicles. Traffic 3, 428-439.
Lee, D.W., Zhao, X., Yim, Y.I., Eisenberg, E., and Greene, L.E. (2008). Essential role of cyclin-G-associated kinase (Auxilin-2) in developing and mature mice. Mol Biol Cell 19, 2766-2776.
Lee, D.W., Zhao, X., Zhang, F., Eisenberg, E., and Greene, L.E. (2005). Depletion of GAK/auxilin 2 inhibits receptor-mediated endocytosis and recruitment of both clathrin and clathrin adaptors. J Cell Sci 118, 4311-4321.
Ray, M.R., Wafa, L.A., Cheng, H., Snoek, R., Fazli, L., Gleave, M., and Rennie, P.S. (2006). Cyclin G-associated kinase: a novel androgen receptor-interacting transcriptional coactivator that is overexpressed in hormone refractory prostate cancer. Int J Cancer 118, 1108-1119.
Shimizu, H., Nagamori, I., Yabuta, N., and Nojima, H. (2009). GAK, a regulator of clathrin-mediated membrane traffic, also controls centrosome integrity and chromosome congression. J Cell Sci 122, 3145-3152.
Smythe, E., and Ayscough, K.R. (2003). The Ark1/Prk1 family of protein kinases. Regulators of endocytosis and the actin skeleton. EMBO Rep 4, 246-251.
Zhang, C.X., Engqvist-Goldstein, A.E., Carreno, S., Owen, D.J., Smythe, E., and Drubin, D.G. (2005). Multiple roles for cyclin G-associated kinase in clathrin-mediated sorting events. Traffic 6, 1103-1113.
Zhang, L., Gjoerup, O., and Roberts, T.M. (2004). The serine/threonine kinase cyclin G-associated kinase regulates epidermal growth factor receptor signaling. Proc Natl Acad Sci U S A 101, 10296-10301.