Mouse activin A receptor type 1

Target ID:

ACVR1Z

Deposition Date:

Tuesday 19th September 2017

Families:

Protein Kinase/TKL

Structure type:

protein-ligand

Download Coordinates:

6EIX

Authors:

Williams, E.P., Canning, P., Sanvitale, C.E., Krojer, T., Allerston, C.K., Von Delft, F., Arrowsmith, C.H., Edwards, A.M., Bountra, C., Bullock, A.N

Site:

Oxford

6EIX

tabs

Structure Details

PDB-code: 6EIX

ACVR1 (also known as ALK2) belongs to the bone morphogenetic protein (BMP) receptor family of transmembrane serine/threonine kinases. Secreted BMPs, which are members of the TGF-beta superfamily involved in endochondral bone formation and embryogenesis, induce heteromeric assembly of type II and type I receptors. Five type II and seven type I receptors, also termed activin-receptor like kinases (ALK1-7) are identified in mammals. All ALKs have a similar sequence and domain structure composed of a ligand-binding extracellular domain, a transmembrane domain, and a cytoplasmic kinase domain (ten Dijke et al., 1993). The type II receptor functions to activate the type I receptor by phosphorylation of its glycine-serine rich (GS) domain. Subsequently, the type I receptor binds and phosphorylates members of the SMAD family of transcription factors. Binding of FKBP12 to the GS domain stabilizes the inactive confirmation of type I receptor and thus prevents leaky activation (Bocciardi et al., 2009; Graham and Peng, 2006).

Mouse models have shown the importance of ACVR1 for cardiac, lens and skeletal development, epithelial-mesenchymal transformation, Müllerian duct regression, generation of primordial gem cells and also for normal mesoderm formation in extraembryonic tissues at the time of gastrulation (Rajagopal et al., 2008; Yu et al., 2008) (Fukuda et al., 2006; Komatsu et al., 2007) (Wang et al., 2005) (de Sousa Lopes et al., 2004; Kaartinen et al., 2004) (Dudas et al., 2004) (Gu et al., 1999) (Mishina et al., 1999) (Ameerun et al., 1996) (Verschueren et al., 1995). Homozygous mutant mice of ACVR1 show morphological defects at E7.0 and have died by E9.5.

Missense mutations in the GS and kinase domains of ACVR1 cause fibrodysplasia ossificans progressiva (FOP), a rare autosomal dominant disorder of skeletal malformations and progressive extraskeletal ossification (Shore et al., 2006). Affected individuals show heterotopic ossification in childhood, which can be induced by trauma or may occur without warning. Bone formation is episodic and progressive, leading to extra-articular ankylosis of all major joints of the axial and appendicular skeleton, rendering movement impossible. Identical mutations are also found in childhood brain tumour DIPG (diffuse intrinsic pontine glioma)(Taylor et al. 2014).

Kinase inhibitors of ACVR1 offer a potential therapeutic against FOP and DIPG and have shown some efficacy in mice (Yu et al. 2008)). Here we present the structure of the Q207E mutant of ACVR1 intracellular domain in complex with a 2-aminopyridine inhibitor (K02288a, Kerr et al. 2015) refined at 2.3 Å resolution.

Materials and Methods

Molecular Biology

Entry Clone Accession:
Entry Clone Source: By PCR
SGC Construct ID: ACVR1Z-c041
Protein Region: T172-C509
Vector: pFB-LIC-Bse
Tag: N-6 HIS;N-TEV
Host: DH10Bac

Sequence (with tag(s)): MGHHHHHHSSGVDLGTENLYFQSMTTNVGDSTLADLLDHSCTSGSGSGLPFLVQRTVAREITLLECVGKGRYGEVWRGSWQGENVAVKIFSSRDEKSWFRETELYNTVMLRHENILGFIASDMTSRHSSTQLWLITHYHEMGSLYDYLQLTTLDTVSCLRIVLSIASGLAHLHIEIFGTQGKPAIAHRDLKSKNILVKKNGQCCIADLGLAVMHSQSTNQLDVGNNPRVGTKRYMAPEVLDETIQVDCFDSYKRVDIWAFGLVLWEVARRMVSNGIVEDYKPPFYDVVPNDPSFEDMRKVVCVDQQRPNIPNRWFSDPTLTSLAKLMKECWYQNPSARLTALRIKKTLTKIDNSLDKLKTDC
Sequence after tag cleavage: SMTTNVGDSTLADLLDHSCTSGSGSGLPFLVQRTVAREITLLECVGKGRYGEVWRGSWQGENVAVKIFSSRDEKSWFRETELYNTVMLRHENILGFIASDMTSRHSSTQLWLITHYHEMGSLYDYLQLTTLDTVSCLRIVLSIASGLAHLHIEIFGTQGKPAIAHRDLKSKNILVKKNGQCCIADLGLAVMHSQSTNQLDVGNNPRVGTKRYMAPEVLDETIQVDCFDSYKRVDIWAFGLVLWEVARRMVSNGIVEDYKPPFYDVVPNDPSFEDMRKVVCVDQQRPNIPNRWFSDPTLTSLAKLMKECWYQNPSARLTALRIKKTLTKIDNSLDKLKTDC DNA Sequence: CCATGGGCCACCATCATCATCATCATTCTTCTGGTGTAGATCTGGGTACCGAGAACCTGTACTTCCAATCCATGACCACCAATGTTGGAGACAGCACTTTAGCAGATTTATTGGATCATTCGTGTACATCAGGAAGTGGCTCTGGTCTTCCTTTTCTGGTACAAAGAACAGTGGCTCGCGAGATTACACTGTTGGAGTGTGTCGGGAAAGGCAGGTATGGTGAGGTGTGGAGGGGCAGCTGGCAAGGGGAAAATGTTGCCGTGAAGATCTTCTCCTCCCGTGATGAGAAGTCATGGTTCAGGGAAACGGAATTGTACAACACTGTGATGCTGAGGCATGAAAATATCTTAGGTTTCATTGCTTCAGACATGACATCAAGACACTCCAGTACCCAGCTGTGGTTAATTACACATTATCATGAAATGGGATCGTTGTACGACTATCTTCAGCTTACTACTCTGGATACAGTTAGCTGCCTTCGAATAGTGCTGTCCATAGCTAGTGGTCTTGCACATTTGCACATAGAGATATTTGGGACCCAAGGGAAACCAGCCATTGCCCATCGAGATTTAAAGAGCAAAAATATTCTGGTTAAGAAGAATGGACAGTGTTGCATAGCAGATTTGGGCCTGGCAGTCATGCATTCCCAGAGCACCAATCAGCTTGATGTGGGGAACAATCCCCGTGTGGGCACCAAGCGCTACATGGCCCCCGAAGTTCTAGATGAAACCATCCAGGTGGATTGTTTCGATTCTTATAAAAGGGTCGATATTTGGGCCTTTGGACTTGTTTTGTGGGAAGTGGCCAGGCGGATGGTGAGCAATGGTATAGTGGAGGATTACAAGCCACCGTTCTACGATGTGGTTCCCAATGACCCAAGTTTTGAAGATATGAGGAAGGTAGTCTGTGTGGATCAACAAAGGCCAAACATACCCAACAGATGGTTCTCAGACCCGACATTAACCTCTCTGGCCAAGCTAATGAAAGAATGCTGGTATCAAAATCCATCCGCAAGACTCACAGCACTGCGTATCAAAAAGACTTTGACCAAAATTGATAATTCCCTCGACAAATTGAAAACTGACTGTTGACAGTAAAGGTGGATACGGATCCGAATTCGAGCTCCGTCGACAAGCTT

Protein Expression

Medium: Insect Xpress
Antibiotics: Ampicillin
Procedure: Sf9 cells at a density of 2x106/ml were infected with recombinant ACVR1 baculovirus (virus stock P3; 2ml of virus stock/1000 ml of cell culture). Cells were shaken at 110 rpm at 27 °C in an Innova shaker. After 72 hours post-infection the cultures were harvested by centrifugation for 20min at 900rpm. Cell pellets from each 1L flask were resuspended in 15 ml binding buffer (50 mM Hepes, pH 7.5; 500 mM NaCl; 5% Glycerol; 5 mM imidazole). Calbiochem protease inhibitor SET V was added to the cell suspension at a 1:2000 dilution and transferred to 50 ml tubes, and stored at -20 °C.

Protein Purification

Procedure: Extraction buffer, extraction method: The frozen cells were thawed and the volume increased to 40 ml with binding buffer. The cells were lysed by sonication over 9 min with the sonicator pulsing ON for 5 sec and OFF for 10 sec. The DNA was precipitated using 0.15% PEI (polyethyleneimine) pH 8. The cell lysate was spun down by centrifugation at 21.5K rpm at 4°C for 1 h. The supernatant was recovered for purification. Column 1: Ni-Affinity Chromatography. 4 ml of 50 % Ni-sepharose slurry was applied onto a 1.5 x 10 cm column. The column was equilibrated with binding buffer (25ml). Buffers: Binding buffer: 50 mM Hepes, pH 7.5; 500 mM NaCl; 5% Glycerol; 5 mM imidazole, 0.1mM TCEP Wash buffer: 50 mM Hepes, pH 7.5; 500 mM NaCl; 5% Glycerol; 25 mM imidazole, 0.1mM TCEPElution buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% Glycerol; 50 to 250 mM imidazole, 0.1mM TCEP Procedure: The supernatant was applied by gravity flow onto the Ni-sepharose column. The bound protein was eluted by applying a step gradient of imidazole using 10 ml portions of elution buffer with increasing concentration of imidazole (50 mM, 100 mM, 150 mM, 250 mM). Enzymatic treatment: 0.1mg of TEV protease was added to the Ni-eluted protein (Overnight incubation at 4 °C) to remove the tag. Column 2: Size Exclusion Chromatography S200 HiLoad 16/60 Superdex run on ÄKTA-Express Buffer: Gel Filtration buffer: 300 mM NaCl, 50 mM Hepes pH 7.5, 0.5mM TCEP Procedure: Prior to applying the protein, the S200 16/60 column was washed and equilibrated with gel filtration buffer. The protein was concentrated to 5 ml using an Amicon Ultra-15 filter with a 10 kDa cut-off. The concentrated protein was directly applied onto the equilibrated S200 16/60 column, and run at a flow-rate of 1 ml/min. The protein was eluted at 90-110 ml. Fractions containing the protein were pooled together. Columns: Column 1: NiNTA 2ml gravity flow affinity column. Column 2: Size Exclusion Chromatography using S200 HiLoad resin; Concentration: 10.0 mg/ml
Mass-spec Verification: The purified protein was homogeneous and had an experimental mass of 40.905 kDa, as expected from primary sequences allowing for N-terminal Met removal and subsequent acetylation. Mass was determined by LC-MS, using an Agilent LC/MSD TOF
system with reversed-phase HPLC coupled to electrospray ionisation and an orthogonal time-of-flight mass analyser. Proteins were desalted prior to mass spectrometry by rapid elution off a C3 column with a gradient of 5-95% acetonitrile in water with 0.1% formic acid.
Compound Exact Mass: 352.142307

Structure Determination

Crystallization: Protein was buffered in 50 mM HEPES pH 7.5, 300 mM NaCl, 10 mM DTT and 10mM L-arginine, 10 mM L-glutamate. The protein was concentrated to 10 mg/ml (calculated using an extinction co-efficient of 58900) in the presence of the inhibitor K02288a (1 mM end concentration). Crystals were grown at 20°C in 150 nl sitting drops mixing 50 nl protein solution with 100 nl of a reservoir solution containing 0.1M MES pH 6.5 and 12%(w/v) PEG 20000. On mounting crystals were cryoprotected with mother liquor plus 25% ethylene glycol before transfer to liquid nitrogen. Data Collection: Diffraction data were collected at the Diamond Light Source, station I03 using monochromatic radiation at wavelength 0.9778 Å. Data could be analysed to a resolution of 2.3 Å. Data Processing: Data were processed with MOSFLM [1] and subsequently scaled using the program AIMLESS from the CCP4 suite. Initial phases were obtained by molecular replacement using the program PHASER and the structure of ALK2 (Protein Data Bank code 3H9R) as a search model. The resulting structure solution was refined using REFMAC5 from the CCP4 suite, and manually rebuilt with COOT. Appropriate TLS restrained refinement using the tls tensor files calculated from the program TLSMD was applied at the final round of refinement. The complete structure was verified for geometric correctness with MolProbity.

References

Ameerun, R.F., de Winter, J.P., van den Eijnden-van Raaij, A.J., den Hertog, J., de Laat, S.W., and Tertoolen, L.G. (1996). Activin and basic fibroblast growth factor regulate neurogenesis of murine embryonal carcinoma cells. Cell Growth Differ 7, 1679-1688.

Bocciardi, R., Bordo, D., Di Duca, M., Di Rocco, M., and Ravazzolo, R. (2009). Mutational analysis of the ACVR1 gene in Italian patients affected with fibrodysplasia ossificans progressiva: confirmations and advancements. Eur J Hum Genet 17, 311-318.

de Sousa Lopes, S.M., Roelen, B.A., Monteiro, R.M., Emmens, R., Lin, H.Y., Li, E., Lawson, K.A., and Mummery, C.L. (2004). BMP signaling mediated by ALK2 in the visceral endoderm is necessary for the generation of primordial germ cells in the mouse embryo. Genes & development 18, 1838-1849.

Dudas, M., Sridurongrit, S., Nagy, A., Okazaki, K., and Kaartinen, V. (2004). Craniofacial defects in mice lacking BMP type I receptor Alk2 in neural crest cells. Mechanisms of development 121, 173-182.

Fukuda, T., Scott, G., Komatsu, Y., Araya, R., Kawano, M., Ray, M.K., Yamada, M., and Mishina, Y. (2006). Generation of a mouse with conditionally activated signaling through the BMP receptor, ALK2. Genesis 44, 159-167.

Graham, H., and Peng, C. (2006). Activin receptor-like kinases: structure, function and clinical implications. Endocrine, metabolic & immune disorders drug targets 6, 45-58.

Gu, Z., Reynolds, E.M., Song, J., Lei, H., Feijen, A., Yu, L., He, W., MacLaughlin, D.T., van den Eijnden-van Raaij, J., Donahoe, P.K., et al. (1999). The type I serine/threonine kinase receptor ActRIA (ALK2) is required for gastrulation of the mouse embryo. Development (Cambridge, England) 126, 2551-2561.

Kaartinen, V., Dudas, M., Nagy, A., Sridurongrit, S., Lu, M.M., and Epstein, J.A. (2004). Cardiac outflow tract defects in mice lacking ALK2 in neural crest cells. Development (Cambridge, England) 131, 3481-3490.

Kerr G, Sheldon H, Chaikuad A, Alfano I, von Delft F, Bullock AN, Harris AL. (2015). A small molecule targeting ALK1 prevents Notch cooperativity and inhibits functional angiogenesis. Angiogenesis. 18(2):209-17.

Komatsu, Y., Scott, G., Nagy, A., Kaartinen, V., and Mishina, Y. (2007). BMP type I receptor ALK2 is essential for proper patterning at late gastrulation during mouse embryogenesis. Dev Dyn 236, 512-517.

Mishina, Y., Crombie, R., Bradley, A., and Behringer, R.R. (1999). Multiple roles for activin-like kinase-2 signaling during mouse embryogenesis. Developmental biology 213, 314-326.

Rajagopal, R., Dattilo, L.K., Kaartinen, V., Deng, C.X., Umans, L., Zwijsen, A., Roberts, A.B., Bottinger, E.P., and Beebe, D.C. (2008). Functions of the type 1 BMP receptor Acvr1 (Alk2) in lens development: cell proliferation, terminal differentiation, and survival. Investigative ophthalmology & visual science 49, 4953-4960.

Shore, E.M., Xu, M., Feldman, G.J., Fenstermacher, D.A., Cho, T.J., Choi, I.H., Connor, J.M., Delai, P., Glaser, D.L., LeMerrer, M., et al. (2006). A recurrent mutation in the BMP type I receptor ACVR1 causes inherited and sporadic fibrodysplasia ossificans progressiva. Nature genetics 38, 525-527.

Taylor KR, Mackay A, Truffaux N, Butterfield Y, Morozova O, Philippe C, Castel D, Grasso CS, Vinci M, Carvalho D, Carcaboso AM, de Torres C, Cruz O, Mora J, Entz-Werle N, Ingram WJ, Monje M, Hargrave D, Bullock AN, Puget S, Yip S, Jones C, Grill J. (2014). Recurrent activating ACVR1 mutations in diffuse intrinsic pontine glioma. Nat Genet. 46(5):457-461.

ten Dijke, P., Ichijo, H., Franzen, P., Schulz, P., Saras, J., Toyoshima, H., Heldin, C.H., and Miyazono, K. (1993). Activin receptor-like kinases: a novel subclass of cell-surface receptors with predicted serine/threonine kinase activity. Oncogene 8, 2879-2887.

Verschueren, K., Dewulf, N., Goumans, M.J., Lonnoy, O., Feijen, A., Grimsby, S., Vandi Spiegle, K., ten Dijke, P., Moren, A., Vanscheeuwijck, P., et al. (1995). Expression of type I and type IB receptors for activin in midgestation mouse embryos suggests distinct functions in organogenesis. Mechanisms of development 52, 109-123.

Wang, J., Sridurongrit, S., Dudas, M., Thomas, P., Nagy, A., Schneider, M.D., Epstein, J.A., and Kaartinen, V. (2005). Atrioventricular cushion transformation is mediated by ALK2 in the developing mouse heart. Developmental biology 286, 299-310.

Yu, P.B., Deng, D.Y., Lai, C.S., Hong, C.C., Cuny, G.D., Bouxsein, M.L., Hong, D.W., McManus, P.M., Katagiri, T., Sachidanandan, C., et al. (2008). BMP type I receptor inhibition reduces heterotopic [corrected] ossification. Nature medicine 14, 1363-1369.